Study Guide for Campbell Biology
11th Edition
ISBN: 9780134443775
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece, Martha R. Taylor, Michael A. Pollock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 16, Problem 4IQ
Look back to Interactive Question 16.2 and label the 5′ and 3′ ends of the left strand of the DNA molecule.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Use the gel diagram below to answer Questions 62 and 63. The positively-charged
electrode of the electrophoresis gel is shown at the bottom of the diagram; the
negatively-charged electrode is at the top. The mixture in each well included the
original DNA fragment, all four dNTPs, one type of ddNTP as labeled in the
diagram, and other necessary components of the dideoxy chain-termination reaction.
The results are below.
ddATP ddGTP ddCTP ddTTP
(A)
(B)
(C)
(D)
(E)
+.
62. Which of the following represents the sequence of the template strand?"
A. 5'--GAAGACTAACATTCA--3'
B. 5'-- ACTTACAATGTAGUA--3'
C. 5'-- CTTCTGATTGTAAGT--3'
D. 5'--ACTTACAATCAGAAG--3'
E. 5'--TGAATGTTAGTCTTC--3'
Please help me answer part b. of question 2.7.
There are 6 parts to this question: This is a follow up to the prior question regarding
the replication of the DNA strand below.
The DNA strand is here for your reference and you do not need to do anything with or
to it.
TC GATATCGG
AGCTATAGCC
c) what enzyme separated the parental DNA template strands,
d) what bonds were broken?
e) what enzyme replicates DNA
f) before DNA can be replicated/copied, what must be laid down to allow the enzyme
in "e" to replicated the DNA (be specific)?
g) our DNA is replicated in many "pieces", what enzyme connects these many "pieces"
into one continuous DNA strand that becomes the sister chromatid?
h) during what specific phase of the cell cycle does this DNA replication process
occur? (This should be a review question from last topics we covered).
Chapter 16 Solutions
Study Guide for Campbell Biology
Ch. 16 - Hershey and Chase devised an experiment using...Ch. 16 - Review the structure of DNA by labeling the...Ch. 16 - Using different colors for heavy (parental) and...Ch. 16 - Look back to Interactive Question 16.2 and label...Ch. 16 - In this diagram of bacterial DNA replication,...Ch. 16 - Draw the last Okazaki fragment being formed on the...Ch. 16 - List the successive levels of packing in a...Ch. 16 - Prob. 1SYKCh. 16 - Prob. 2SYKCh. 16 - One of the reasons most scientists thought...
Ch. 16 - Transformation involves a. the uptake of external...Ch. 16 - Prob. 3TYKCh. 16 - Which of the following most closely represents...Ch. 16 - Prob. 5TYKCh. 16 - Prob. 6TYKCh. 16 - In their classic experiment, Meselson and Stahl a....Ch. 16 - The joining of nucleotides in the polymerization...Ch. 16 - DNA polymerase is not able to begin copying a DNA...Ch. 16 - Prob. 10TYKCh. 16 - Prob. 11TYKCh. 16 - Prob. 12TYKCh. 16 - Which of the following is least related to the...Ch. 16 - Prob. 14TYKCh. 16 - Prob. 15TYKCh. 16 - Prob. 16TYKCh. 16 - Prob. 17TYKCh. 16 - Which of the following statements about telomeres...Ch. 16 - You are trying to test your hypothesis that DNA...Ch. 16 - Given the experimental procedure explained in...Ch. 16 - Prob. 21TYKCh. 16 - Biologists have learned from the technique of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- https://youtu.be/8kK2zwjRV0M Describe the purpose or theme of the video. Question 2 What are the chemical components of a DNA nucleotide? Question 3 List three characteristics of the structure of the DNA molecule. Question 4 Suppose you have a 5'-AGAGTGCGTA-3' sequence on one strand of the DNA. What is the base sequence that should appear on the other complementary strand of the DNA?arrow_forwardGive only typing answer with explanation and conclusion Write Dotplot alghorithm for finding inversions between the following DNAs in Python. Sequence 1: 5' - GCTAGGACCTTGATAGAACCATGCATGCATGCATGCAGTCTGGTCACTATGCCGTC - 3' Sequence 2: 5' - TACGTATCGGCGTTAGCGTAGCATGCATGCATGCATCGATGCCTAACGTTCTAAGC - 3'arrow_forwardTranslate the sequence of bases in the previous question, starting at the second base.arrow_forward
- Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a strand is shown magnified and rotated. Identify whether it is the 5' end or the 3′ end, and identify the base. Answer Bank 5' cytosine 3' guanine 3' thymine major groove minor groove 5' adeninearrow_forwardThe diagram below is of a short stretch of prokaryotic chromosomal DNA in the process of replication.Please supply the specific pieces of information requested by the boxes below.arrow_forwardIf the sequence T-A-C-C-C-T appears on the informational strand of DNA, what sequence appears opposite it on the template strand? Label your answer with 3′ and 5′ ends.arrow_forward
- Give typing answer with explanation and conclusionarrow_forwardA DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide Lengtharrow_forwardGive typing answer with explanation and conclusion What is the complete base composition of a double-stranded eukaryotic DNA that contains 23 % adenosine?arrow_forward
- Read the images given before answering the question below. Identify the two common diseases that result from mutations in gene A?arrow_forwardThe illumina method of sequencing uses a unique type of nucleotide building block. What is the specific characteristic of this type of nucleotide that is important for this method of sequencing? How is the sequence of a fragment of DNA determined using this method? (USE THIS LINK AND WRITE ANSWERS IN YOUR LANGUAGE PLEASE DON'T COPY SAME AS GIVEN IN SITE https://www.mybiosource.com/learn/testing-procedures/dna-sequencing/arrow_forwardPlease help mearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license