Study Guide for Campbell Biology
11th Edition
ISBN: 9780134443775
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece, Martha R. Taylor, Michael A. Pollock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 16, Problem 6TYK
Summary Introduction
Introduction: Nucleotides are ubiquitous molecules and building blocks of the
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In the Watson-Crick structure of DNA, the:
a. adenine content of one strand must equal the thymine content of the same strand.
b. nucleotides are arranged in the A-form.
c. purine content (fraction of bases that are purines) must be the same in both strands.
d. two strands are parallel.
e. the strands are complementary to each other.
The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate
groups are filled circles.
A. Is this a DNA or an RNA Molecule?
B. Where is the 3’ end of this tetranucleotide?
C. Given that the DNA strand which served as a template for the synthesis of this
tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?
Suppose the following base sequence was found in a 20-base DNA polymer.
3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5'
a. What would be the first 5 bases at the 3' end of the complementary strand?
b. What would be the first 10 bases at the 5' end of the complementary
strand?
c. Assuming the presence of the complementary strand, what is the
percentage composition of the polymer with respect to the A-T base pair?
with respect to the G-C base pair?
d. In the given segment in problem 1, illustrate and indicate the direction of the
synthesis of:
i. a 5-nucleotide RNA primer
ii. a 5-nucleotide Okazaki fragment
Chapter 16 Solutions
Study Guide for Campbell Biology
Ch. 16 - Hershey and Chase devised an experiment using...Ch. 16 - Review the structure of DNA by labeling the...Ch. 16 - Using different colors for heavy (parental) and...Ch. 16 - Look back to Interactive Question 16.2 and label...Ch. 16 - In this diagram of bacterial DNA replication,...Ch. 16 - Draw the last Okazaki fragment being formed on the...Ch. 16 - List the successive levels of packing in a...Ch. 16 - Prob. 1SYKCh. 16 - Prob. 2SYKCh. 16 - One of the reasons most scientists thought...
Ch. 16 - Transformation involves a. the uptake of external...Ch. 16 - Prob. 3TYKCh. 16 - Which of the following most closely represents...Ch. 16 - Prob. 5TYKCh. 16 - Prob. 6TYKCh. 16 - In their classic experiment, Meselson and Stahl a....Ch. 16 - The joining of nucleotides in the polymerization...Ch. 16 - DNA polymerase is not able to begin copying a DNA...Ch. 16 - Prob. 10TYKCh. 16 - Prob. 11TYKCh. 16 - Prob. 12TYKCh. 16 - Which of the following is least related to the...Ch. 16 - Prob. 14TYKCh. 16 - Prob. 15TYKCh. 16 - Prob. 16TYKCh. 16 - Prob. 17TYKCh. 16 - Which of the following statements about telomeres...Ch. 16 - You are trying to test your hypothesis that DNA...Ch. 16 - Given the experimental procedure explained in...Ch. 16 - Prob. 21TYKCh. 16 - Biologists have learned from the technique of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Ethidium Bromide is a chemical reagent that has been used to detect the presence of nucleic acids. It is known to fluoresce under UV light and the intensity of the fluoresence increases when it binds to the nucleic acids. Ethidium Bromide binds to polynucleotides a by binding directly to the bases on one of the strands. b by intercalating itself between the base pair stacks. c through the negatively charged phosphate groups. d through the hydroxyl group of the sugar molecule.arrow_forwardIndicate whether each of the following statements about the double-helix secondary structure of DNA is true or false. a. The two polynucleotide strands are complementary rather than identical. b. Bases present extend outward from the double helix. c. Covalent bonding occurs between the two polynucleotide strands. d. The two polynucleotide strands run in the 5′-to-3′ directionarrow_forward(5')GTGATCAAGC(3') could only form a double-stranded structure with: a. (5')CACTAGTTCG(3'). b. (5')CACUAGUUCG(3'). c. (5')CACUTTCGCCC(3'). d. (5')GCTTGATCAC(3'). e. (5')GCCTAGTTUG(3').arrow_forward
- The major reason that antiparallel beta-stranded protein structures are more stable than parallel beta-stranded structures is that: Select one: a. parallel ones are in a slightly less extended configuration than antiparallel strands. b. parallel ones do not have as many disulfide crosslinks between adjacent strands. c. parallel ones do not stack in sheets as well as antiparallel strands. X d. parallel ones have fewer hydrogen bonds than antiparallel strands. e. parallel ones have weaker hydrogen bonds between adjacent strands.arrow_forward4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA Template Strand: TACACATCACGCTCAACT a) What would be the amino acid sequence coded for by the template strand of the DNA molecule above? 7. a) Are codons found in DNA or RNA? b) How many bases are in a codon? c) Give an example of a codon.arrow_forwardWhich of the following is true regarding the 5’ vs. the 3’ end of a strand of DNA? a) only double-stranded DNA can have a 5' and a 3' end b) 5' and 3' are designations of the carbon in the deoxyribose of a nucleotide that is not bound to another deoxyribose or phosphate group c) 5' and 3' are designations of the DNA base that is unbound to another base d) The 5' end of DNA is always considered the start of the gene and the 3' end is considered the endarrow_forward
- Write the base sequence in a complementary DNA segment if each original segment has the following base sequence: a.) 5'T T T T T T 3' b.) 5'C C C C C C C C C 3' c.) 5'A T G G C A 3' d.) 5'A T A T G C G C T A A A 3'arrow_forward1. In a sample solution given for analysis; CATAGCTTTGTTAAA (DNA nucleotide chain). a) Show the 5 'and 3' ends by writing in triplet (codon) form. Find the number of Hydrogen bonds in the double helix DNA strand at the beginning. b) Find the peptide sequence that this DNA chain will synthesize and show the energy balance required for its synthesis and indicate its total load at physiological pH. c) How do you prove that this peptide sequence is as above? Explain.arrow_forwardFor entertainment on a Friday night, a genetics professor proposed that his children diagram a polynucleotide strand of DNA. Having learned about DNA in preschool, his 5-year-old daughter was able to draw a polynucleotide strand, but she made a few mistakes. The daughter’s diagram (represented here) contained at least 10 mistakes. a. Make a list of all the mistakes in the structure of this DNA polynucleotide strand. b. Draw the correct structure for the polynucleotide strand.arrow_forward
- You are characterizing a DNA-binding protein, and have used genetic experiments to identify a domain required for the interaction of the protein with DNA. Your secondary structure analysis software predicts that the domain forms a β helix, but you are unconvinced. What experiments could you perform to confirm the presence of a β helix in this region?arrow_forwardIndicate whether each of the following base-pairing situations (1) involves two DNA strands, (2) involves a DNA strand and an RNA strand, or (3) could involve either two DNA strands or a DNA strand and an RNA strand? a. A G T U C A b. A C T T G A c. A G U T C A d. C G C G C G a. A G T U C A b. A C T T G A c. A G U T C A d. C G C G C Garrow_forwardWhat is the effect of incubating a mixture of RNA and DNA with 0.1 M NaOH? A. DNA is hydrolyzed to nucleoside monophosphates. B. No effect. RNA and DNA are resistant to base hydrolysis. C. RNA is hydrolyzed to nucleoside monophosphates. D. Both RNA and DNA are hydrolyzed to nucleoside monophosphates. Stem-loop structures in RNA resemble the ________ form of double-helical DNA. A. A B. B C. supercoiled circular D. Zarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License