Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
The diagram below is of a short stretch of prokaryotic chromosomal DNA in the process of replication.
Please supply the specific pieces of information requested by the boxes below.
Expert Solution
arrow_forward
Step 1
Introduction
The process of duplicating a double-stranded DNA molecule into two identical DNA molecules is known as DNA replication.
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Indicate where each of the following processes occurs (nucleus, cytoplasm or mitochondria).Translation AnswerTranscription AnswerDNA replication Answerarrow_forwardWhich of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5'-3'. OA. AAGAUCGUCGAUCGGUCAUG OB. AAGATCGTCGATCGG TCATG OC. GTACTGGC TAGCTGC TAGAA OD. GUACUGGCUAGCUGCUAGAAarrow_forwardComplete the sentences describing the sense of hearing with the correct terms and then put them into the correct chronological order. Drag the text blocks below into their correct order. outer ear vestibular canal shorter cutaneous membrane basilar membrane longer lateral membrane oval inner ear round tympanic membrane The collects sound waves and causes the to vibrate Waves are dissipated when they strike the Waves of cause the The tympanic membrane causes the ossicles to vibrate, which then vibrate against the window. window length travel through the cochlear duct and to vibrate. Pressure waves then travel to the tympanic canal. and then to thearrow_forward
- The following is the base sequence on the coding strand of a DNA molecule: AAT GCC AGT GGT TCG CAC Coding DNA: _________________________________________Template DNA: _________________________________________ mRNA: _________________________________________ Amino acids: _________________________________________ Mutation 1 A) Coding DNA: _________________________________________Template DNA: _________________________________________ mRNA: _________________________________________ B) amino acids: _________________________________________arrow_forwardName the bacterial enzyme that takes over new strand synthesis in replication after the primer is formed. Please include any number that is applicable. DNA polymerase omega DNA polymerase II DNA Polymerase epsilon DNA polymerase delta O DNA Polymerase Iarrow_forwardThe enzymatic activity of prokaryotic DNA polymerases is faster than that of eukaryotic DNA polymerases, but the overall rate of DNA replication is faster in eukaryotes than prokaryotes. How is this possible? Group of answer choices Prokaryotic but not eukaryotic DNA replication requires a primer. Eukaryotic but not prokaryotic DNA replication proceeds from multiple origins. Prokaryotic DNA replication is a more complex process, with time-consuming polymerase switching that is not needed in eukaryotes. Prokaryotic but not eukaryotic DNA replication proceeds from both 5’ --> 3’ and 3’ --> 5’ Prokaryotic DNA polymerases and not eukaryotic polymerases have proofreading ability.arrow_forward
- Draw and label a diagram showing four DNA nucleotides, linked together in two strands. PLEASE DRAW ON PAPERarrow_forwardThere are 2 parts to this question: The following DNA strand (below) is about to undergo DNA replication. a) Please replicate the parental strands into two exact copies TC GATATCGG AGCTATAGCC b) place a centromere between the two replicated copies (or tell me where the centromere would be located),arrow_forwardWhat are the differences between In vitro and In vivo DNA replication? Please answer at your own words.arrow_forward
- Drag and drop the following terms into the correct spots on the image below. 1. Amino Acids 2. Codon 3. mRNA 4. Ribosome 5. tRNAarrow_forwardWhat enzymes are required for the initiation of replication in eukaryotes? Are these complexes the same or different in prokaryotes? Answer in 2-3 sentences.arrow_forward______________ is a kind of spontaneous mutation that results from a short-term, reversible phenomenon that leads to abnormal base pairing during DNA replications, followed by another round of DNA replication which results in one of the two daughter DNA molecules containing a point mutation. Group of answer choices Tautomeric shift Frameshift mutation Nonsense mutation Pyrimidine dimer Conditional mutationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education