Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 1EQ
Answer the following questions that pertain to the experiment of Figure 14.7.
A. Why was
B. The optical density values were twice as high for the mated strain as for the parent strain. Why was this result obtained?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The following table lists 4 bacterial strains that are partial diploids for lac operon genes. Given the
activity of beta-galactosidase measured for each strain in the absence (-lac) or presence (+lac) of
lactose, complete the table by choosing the appropriate symbol (+, -, C, S) to indicate the allele of
the gene or site missing from the table (blue numbers).
+ = wildtype, - = null mutation, c = constitutive, s =super repressor
chromosome
plasmid
B-gal act.
strain
10
Z
A
1 C
B
3
4
+
C
+
6
D
9
+
1
[Select]
3 [Select]
5 [Select]
7
[ Select]
9 [Select]
| 0
2
+
+ 5
+
7
10
Z
+
-lac
+lac
0.062 0.058
0.003
0.004
0.062 0.117
0.003 0.060
+
8
+
2 [Select]
4 [Select]
6 [Select]
8 [Select]
10
[Select]
Suppose you have six strains of E. coli. One is wildtype, and each of the other five has a single one of thefollowing mutations: lacZ−, lacY−, lacI−, oc, andlacIS. For each of these six strains, describe thephenotype you would observe using the following assays. [Notes: (1) IPTG is a colorless synthetic molecule that acts as an inducer of lac operon expressionbut cannot serve as a carbon source for bacterialgrowth because it cannot be cleaved byβ-galactosidase; (2) X-gal cannot serve as a carbonsource for growth; (3) E. coli requires active lactosepermease (the product of lacY) to allow lactose,X-gal, or IPTG into the cells.] Colony color in medium containing glycerol as theonly carbon source and X-gal, but no IPTG.d. Colony color in medium containing high levels ofglucose as the only carbon source, X-gal, andIPTG.e. Colony color in medium containing high levels ofglucose as the only carbon source and X-gal, butno IPTG
The following shows the genotype of a partial diploid bacterial cell - where one chromosomal region containing the lac operon in E,coli is given, and the other fragment is from a plasmid carrying another lac operon from another source. The two are separated by a slash (/).
The possible answers indicate with a ʺ+ʺ or a ʺ-ʺ whether β-galactosidase would be expected to be produced at induced levels under two circumstances: 1) first in the absence of lactose and 2) second in the presence of lactose. (Assume that glucose is not present in the medium.)Genotype F: I+ Oc Z-/ Fʹ I- O+ Z+
KEY:I+ = wild-type repressorI- = mutant repressor (unable to bind to the operator)Is = mutant repressor (insensitive to lactose)O+ = wild-type operatorOc = constitutive operator (insensitive to repressor)
Chapter 14 Solutions
Genetics: Analysis and Principles
Ch. 14.1 - 1. A repressor is a __________ that _________...Ch. 14.1 - 2. Which of the following combinations will cause...Ch. 14.2 - 1. What is an operon?
a. A site in the DNA where...Ch. 14.2 - The binding of _______ to lac repressor causes lac...Ch. 14.2 - Prob. 3COMQCh. 14.2 - How does exposing an E. coli cell to glucose...Ch. 14.3 - When tryptophan binds to trp repressor, this...Ch. 14.3 - During attenuation, when tryptophan levels are...Ch. 14.3 - Operons involved with the biosynthesis of...Ch. 14.4 - 1. Translation can be regulated by
a....
Ch. 14.4 - Prob. 2COMQCh. 14.5 - 1. For a riboswitch that controls transcription,...Ch. 14 - 1. What is the difference between a constitutive...Ch. 14 - In general, why is it important to regulate genes?...Ch. 14 - Prob. 3CONQCh. 14 - Transcriptional regulation often involves a...Ch. 14 - An operon is repressible-a small effector molecule...Ch. 14 - Prob. 6CONQCh. 14 - 7. What is enzyme adaptation? From a genetic point...Ch. 14 - Prob. 8CONQCh. 14 - Prob. 9CONQCh. 14 - Prob. 10CONQCh. 14 - Mutations may have an effect on the expression of...Ch. 14 - 12. Would a mutation that inactivated lac...Ch. 14 - Prob. 13CONQCh. 14 - 14. As shown in Figure 14.12, four regions within...Ch. 14 - 15. As described in Chapter 13, enzymes known as...Ch. 14 - 16. The combination of a 3–4 stem-loop and a...Ch. 14 - 17. Mutations in tRNA genes can create tRNAs that...Ch. 14 - Prob. 18CONQCh. 14 - Prob. 19CONQCh. 14 - A species of bacteria can synthesize the amino...Ch. 14 - 21. Using three examples, describe how allosteric...Ch. 14 - How are the actions of lac repressor and trp...Ch. 14 - 23. Transcriptional repressor proteins (e.g., lac...Ch. 14 - Answer the following questions that pertain to the...Ch. 14 - Chapter 21 describes a blotting method known as...Ch. 14 - As described in experimental question E2 and also...Ch. 14 - Prob. 4EQCh. 14 - Explain how the data shown in Figure 14.9 indicate...Ch. 14 - Prob. 6EQCh. 14 - Lets suppose you have isolated a mutant strain of...Ch. 14 - Prob. 1QSDCCh. 14 - Prob. 2QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If a wild-type (normal, NOTmutated) E. coli strain is grown in a medium: a. without lactose or glucose, how many proteins (and which ones) are bound to the lac operon? b. Without lactose, but with glucose, how many proteins (and which ones) are bound to the lac operon??arrow_forwardAnother class of suppressor mutations, not describedin the chapter, are mutations that suppress missensemutations.a. Why would bacterial strains carrying such missense suppressor mutations generally grow moreslowly than strains carrying nonsense suppressormutations?arrow_forwardGiven the following genotypes, explain, by answering the questions in each number, how the mutation (identified by a (-) superscript) will affect E. coli grown in lactose medium. Will there be a complete set ofgene products? (Yes/No) Will the lac operon be turnedon/off? Will the cell survive? (Yes/No) a. i + p + o + z - y + b. i + p - o + z + y + c. i + p + o - z + y +arrow_forward
- Answer the following questions: 1. Given the following genotypes, explain how the mutation (identified by a () superscript will affect E. coli grown in lactose medium. Will the lac operon be on or off? Will there be a complete set of gene products from the loc operon? What will be the implication of the missing gene product, if ever? Will the cell be able to survive in the lactose medium or not? a. p' oE Y b. p'o Y d. po varrow_forwardThe cellulase gene of Bacillus licheniformis was successfully cloned into the pET21a vector and expressed in Escherichia coli BL21. The pET21a vector consists of ampicillin resistant gene. To screen for the successful transformants, E. coli BL21 was cultivated on LB agar containing ampicillin (100 pg/mL) and 0.5% (w/v) carboxymethylcellulose, and incubated at 37 0C for 6 hours. After that the agar plate was stained with Congo red solution for 15 minutes and washed twice with sodium chloride solution and the observation is as shown in Figure 3. Answer the following: (i.) Briefly explain why ampicillin was added to the LB agar. (ii) Indicate the function of carboxymethylcellulose in the LB agar. (iii) Conclude how the researchers were able to identify the E. coli BL21 that carried the cellulase gene.arrow_forwardYou are interested in studying resistance to heavy metals and have selected the yeast Saccharomyces cerevisea to conduct your studies. You have recovered a deletion mutant that does not tolerate high concentrations of zinc (grows poorly in zinc containing media ) and have designated the mutant pgz-1 (for poor growth in zinc ). (a) What is the advantage to the type of mutant used in this work? What class of mutagen was likely use to generate pgz-1? ( b) Do you expect the PGZ gene to be expressed in your mutant? Explain.arrow_forward
- a. The original constitutive operator mutations in thelac operon were all base changes in o1. Why doyou think mutations in o2 or o3 were not isolated inthese screens?b. Explain how a mutagen that causes small insertions could produce an ocmutation.c. Would a strain with one of the ocmutations described in part (b) and also a lacIS mutation be ableto make β-galactosidase either in the presence orabsence of inducer? Explainarrow_forwardA graduate student studying the pathogenic bacteria Acinetobacter baumannii made cDNA from planktonic cells and biofilm cells and performed RNA-Seq on both samples. She aligned her sequencing reads to a locus of the baumannii genome as shown. a. Which genes are on an operon together? Explain which data supports this? b. What is the most expressed transcript from the locus in Planktonic culture? c. Order the transcripts from largest increase in relative expression between biofilm and planktonic cells to the largest decrease in relative expression. d. When this data was compared to microarray transcriptional profiling, the microarray data provided lower expression levels for the most highly expressed transcripts. Why did this occur?arrow_forwardMutation analysis of GCK gene in patients with diabetes revealed a c.114 T->A (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGCATGGCAGCTCTAATGACAGGATGGTCACCCCTG СTGAGGCCACTCCTGGTCACCATGACAАССАCAGGCCCTCTТСAGTATCACAGTAAGCCCTGGCAGG AGAATCCCCCACTCCACACCTGGCTGGAGCACGAAATGCCGAGCGGCGCCTGAGCCCCAGGGAAG CAGGCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Bestriction enzyme Recognition sequence Nari GG/CGCC Ddel C/TOAG Hae II DGCGC/n Hpal cc/GG Alul AG/CT Smal ccc/GGG Mbol /GATC Mae II IGTDAC Bsp 1286 I GNGCn/c Hind II A/AGCTT ECOR I G/AATTC D: any Ducleotide 1:…arrow_forward
- A number of mutations affect the expression of the lac operon in E. coli. The genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene with normal function and "-" indicates a loss-of-function allele.) Please predict which of the following strains would have the lowest beta-galactosidase enzyme activity, when grown in the lactose medium. OF POZY Ort Ptot Z¹ Yt Ort p²o+z¹Y+ Orpt ot ztyarrow_forwardA research group is studying a bacterium X that binds to mucosal cells in the lung and invades. Wildtype X has an LD50 value of 10 bacteria when administered to mice by inhalation. Using transposon mutagenesis, the researchers have isolated two mutants of X that they call Xmut1 and Xmut2, both of which have LD50 values of 105 when inhaled by mice. However, in tissue culture cells, Xmut1 can invade the cells just as well as wild-type X, while Xmut2 cannot. Provide a possible explanation for these results.arrow_forwardMutation analysis of GCK gene in patients with diabetes revealed a c.114 T→A (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) Which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) Draw the expected agarose gel result of a homozygous wild type, homozygous mutant and heterozygote individual after restriction enzyme analysis. ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGCATGGCAGCTCTAATGACAGGATGGTCACCCCTGCTGAGGCC ACTCCTGGTCACCATGACAACCACAGGCCCTCTCAGTATCACAGTAAGCCCTGGCAGGAGAATCCCCCACTCCAC ACCTGGCTGGAGCACGAAATGCCGAGCGGCGCCTGAGCCCCAGGGAAGCAGGCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Restriction enzyme Recognition seguence www wwwtw ww Nar I GG/CGCC…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license