Life: The Science of Biology
11th Edition
ISBN: 9781319010164
Author: David E. Sadava, David M. Hillis, H. Craig Heller, Sally D. Hacker
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 13, Problem 4Q
Summary Introduction
To explain:
The radioactive (labeled) and the nonradioactive (non-labeled)
Introduction:
The DNA is duplicated in the S (synthesis) phase of the cell cycle. The duplication process can be traced by detecting the incorporation of the radioactively labeled thymidine in the DNA of the S phase cells.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
suppose there are three tubes containing DNA RNA and protein samples in THE laboratory. the three tubes are unlabeled and are shuffled, how will you identify them?
Draw the structure of a dideoxynucleotide that would be used for DNA sequencing, and explain why they result in chain termination. Write out the sequence of the first 20 nucleotides for the gene shown in the sequencing gel below (remember to start at the bottom of the gel and work upward, from smallest to largest fragments).
If the length of E.coli DNA is 1.36 mm, calculate the number of base pairs it contains
Chapter 13 Solutions
Life: The Science of Biology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the experiment conducted by Meselson and Stahl in which they used 14N and 15N in cultures of E. coli and equilibrium density gradient centrifugation. Draw pictures to represent the bands produced by bacterial DNA in the centrifuge tube before the switch to medium containing 14N and after one, two, and three rounds of replication in that medium. Use separate sets of drawings to show the bands that would appear if replication were (a) semiconservative; (b) conservative; (c) dispersive.arrow_forwardUse a drawing to illustrate the principle of DNA gel electrophoresis. (2 marks)-+arrow_forwardThe table below summarises the three stages of Meselson and Stahl's experiment and their results. (a) Complete the table by drawing, in the appropriate boxes, diagrams of the DNA molecules and mark the position and size of the DNA bands in the tubes. Experimental stage Diagram to show the strands in the DNA Position and size of DNA bands in the tube of molecules of the bacteria separating solution Stage 1 Bacteria grown for several generations in culture medium containing heavy nitrogen Stage 2 The bacteria from the end of stage 1 were grown for another generation in culture medium containing light nitrogen TA2G - Completed forms must be available for Open Awards extermal moderation purposes. Page 7 of 13 Stage 3 The bacteria from the end of stage 2 were grown for one more generation in culture medium containing light nitrogen (b) The bacteria at the end of stage two were grown for five more generations. After each generation, what would you expect to see in the test tube? Draw these…arrow_forward
- A DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide Lengtharrow_forwardWhich strand of DNA (upper or lower) in Figure 16.8 is the template strand? Explain your reasoning.arrow_forwardIn Noll’s experiment , explain where DNase I cuts the DNA. Why were the bands on the gel in multiples of 200 bp at lower DNase I concentrations?arrow_forward
- On the gel diagram below, show how you believe these fragments will sort out during electrophoresis. Label each fragment with its correct number of base pairs. (8 fragments)arrow_forwardPCR is a molecular biology technique where template DNA is amplified using a primer and oligonucleotides. The reaction is catalyzed by a thermostable DNA polymerase and in a particular reaction, the template strands are denatured at 95˚C. For strand hybridization, the melting temperature is 55˚C. What do you predict about the average duration of H bonds at the high temperature in comparison to the low temperature?arrow_forwardHow many kilobases of the DNA strand below will code for the protein product?arrow_forward
- State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helixarrow_forwardUse a drawing to illustrate the principle of DNA gel electrophoresis. Indicate roughly the comparative electrophoretic mobilities of DNAs with 150, 600, and 1200 bp.arrow_forwardThe sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
DNA Use In Forensic Science; Author: DeBacco University;https://www.youtube.com/watch?v=2YIG3lUP-74;License: Standard YouTube License, CC-BY
Analysing forensic evidence | The Laboratory; Author: Wellcome Collection;https://www.youtube.com/watch?v=68Y-OamcTJ8;License: Standard YouTube License, CC-BY