Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 29ESP
Shown here are the amino acid sequences of the wild-type and three mutant forms of a short protein.
Use this information to answer the following questions:
- (a) Using Figure 13.7, predict the type of mutation that led to each altered protein.
- (b) For each mutant protein, determine the specific ribonucleotide change that led to its synthesis.
- (c) The wild-type RNA consists of nine triplets. What is the role of the ninth triplet?
- (d) Of the first eight wild-type triplets, which, if any, can you determine specifically from an analysis of the mutant proteins? In each case, explain why or why not.
- (e) Another mutation (mutant 4) is isolated. Its amino acid sequence is unchanged from wild type, but the mutant cells produce abnormally low amounts of the wild-type proteins. As specifically as you can, predict where this mutation exists in the gene.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Given the following Wild Type and Mutated DNA sequences:
1.) Identify where the base pair change occurs ( what letter changed?)
2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences.
3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein.
Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5'
Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’.
2a). Following transcription, what is the total number of codons in the mRNA transcript?
2 b). Where is the start codon located in this mRNA transcript?
2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
Sickle cell anemia is a widespread disease in many African countries and can be caused by a
change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with
the disease and a genetic fingerprint reveals the following DNA sequence for the gene:
(a)
(b)
(c)
(d)
(e)
Write down the mRNA sequence for the given DNA sense strand indicating the
polarity.
Derive the polypeptide from the mRNA molecule using the table of the genetic code
(Table Q1 below) again indicating the polarity of the peptide chain.
Indicate the position in the DNA molecule that could have caused the disease and write
down all possible point mutations in the DNA sequence that could have caused it. [
The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write
down all possible t-RNA molecules with their anti-codons that are used to polymerize
the amino acid VAL. Indicate the polarity.
3'-TAC TGA GCA AGA TTA CAT ACT-5'
Explain what is meant by redundancy of the genetic code.…
Chapter 13 Solutions
Concepts of Genetics (12th Edition)
Ch. 13 - In a mixed heteropolymer experiment using...Ch. 13 - When repeating copolymers are used to form...Ch. 13 - The following represent deoxyribonucleotide...Ch. 13 - Prob. 1CSCh. 13 - A 30-year-old woman was undergoing therapy for...Ch. 13 - A 30-year-old woman was undergoing therapy for...Ch. 13 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 13 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 13 - Assuming the genetic code is a triplet, what...Ch. 13 - The mRNA formed from the repeating tetranucleotide...
Ch. 13 - In studies using repeating copolymers, AC ......Ch. 13 - In a coding experiment using repeating copolymers...Ch. 13 - Prob. 7PDQCh. 13 - When the amino acid sequences of insulin isolated...Ch. 13 - Prob. 9PDQCh. 13 - Why doesnt polynucleotide phosphorylase (Ochoas...Ch. 13 - Refer to Table 13.1. Can you hypothesize why a...Ch. 13 - Predict the amino acid sequence produced during...Ch. 13 - A short RNA molecule was isolated that...Ch. 13 - A glycine residue is in position 210 of the...Ch. 13 - Refer to Figure 13.7 to respond to the following:...Ch. 13 - Most proteins have more leucine than histidine...Ch. 13 - Define the process of transcription. Where does...Ch. 13 - Prob. 18PDQCh. 13 - Describe the structure of RNA polymerase in...Ch. 13 - Prob. 20PDQCh. 13 - Messenger RNA molecules are very difficult to...Ch. 13 - Present an overview of various forms of...Ch. 13 - One form of posttranscriptional modification of...Ch. 13 - Describe the role of two forms of RNA editing that...Ch. 13 - Substitution RNA editing is known to involve...Ch. 13 - Prob. 26ESPCh. 13 - Prob. 27ESPCh. 13 - Prob. 28ESPCh. 13 - Shown here are the amino acid sequences of the...Ch. 13 - The genetic code is degenerate. Amino acids are...Ch. 13 - M. Klemke et al. (2001) discovered an interesting...Ch. 13 - Recent observations indicate that alternative...Ch. 13 - Isoginkgetin is a cell-permeable chemical isolated...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How does the aminoacyl-tRNA synthetase that attaches the amino acid proline know which tRNA to attach the proline to?Question 24 options: A) the synthetase recognizes the sequence of the first 3 bases on the 3' end of the tRNA B) the synthetase reads the anticodon as well as a few other unique bases in tRNAPro C) proline only fits into the 3-dimensional structure of the tRNAPro D) the synthetase randomly chooses a tRNAarrow_forwardUsing a table that shows which codon represents which amino acid determine the following: A) The possible codons that encode Serine: B) The amino acids that could be encoded if the 2nd position of the UCA codon that encodes Serine was changed to one of the other 3 bases: C) The amino acids that could be encoded if the 3rd position of the UCA codon that encodes Serine was changed to one of the other 3 bases: D) The amino acids that could be encoded if the 1st position of the UCA codon that encodes Serine was changed to one of the other 3 bases:arrow_forwardThe genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?arrow_forward
- Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?arrow_forward5'......TACTGCCCATGCCCAGAGAGAAAGCGCAGACGCGTCTAAactgt... 3' a). (10 points). In the above sequences, the open reading frame is indicated by alternating non-underlined and underlined triplets. Please use the codon table to deduce the amino acid sequence for the region shown in the wildtype protein. Wildtype AA sequence for the region around mutation #1: Wildtype AA sequence for the region around mutation #2: b). (10 points). Please make predictions what molecular change mutation #1 and mutation #2 cause. c). (5 points). Which mutation is more likely to abrogate the protein function? Why?arrow_forwardBased on the N-terminal amino acid sequence, what is the approximate half-life of the protein after methionine is cleaved off?arrow_forward
- Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provideanswers for the following questions?1) Define the silent mutation in DNA? (2.5 marks)2) What is the codon usage bias? (2.5 marks)3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics? (10.0 marks)arrow_forwardThe protein Xpot transports tRNAs out of the nucleus so that they can be aminoacylated in the cytosol. (a) What tRNA structural features is Xpot likely to recognize? (b) How does Xpot distinguish mature tRNAs from pre-tRNAs?arrow_forwardPompe disease is a rare genetic condition resulting from a deficiency of the protein alpha-glucosidase. The following three mutations are among the 100+ mutations known or suspected of causing the disease. Context is provided in parentheses. Provide a brief hypothesis as to why the change would be damaging to the protein. a.) L571P (located in a helix buried in the protein interior)arrow_forward
- Shown here is a theoretical viral mRNA sequence 5′-AUGCAUACCUAUGAGACCCUUGGA-3′ (a) Assuming that it could arise from overlapping genes, how many different polypeptide sequences can be produced? Using the chart in Figure 12–7, what are the sequences? (b) A base-substitution mutation that altered the sequence in part (a) eliminated the synthesis of all but one polypeptide. The altered sequence is shown below. Use Figure 12–7 to determine why it was altered. 5′-AUGCAUACCUAUGUGACCCUUGGA-3′arrow_forwardRefer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)arrow_forwardRefer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY