Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 13, Problem 6PDQ
In a coding experiment using repeating
AGG is known to code for arginine. Taking into account the wobble hypothesis, assign each of the four codons produced in the experiment to its correct amino acid.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
In HbS, the human hemoglobin found in individuals with sickle-cell anemia, glutamic acid at position 6 in the beta chain is replaced by valine.
Q.) Show that one of the glutamic acid codons can be converted to a valine codon by a single substitution mutation (i.e., by changing one letter in one codon).
In a coding experiment using repeating copolymers , the following data were obtained: Copolymer Codons Produced Amino Acids in Polypeptide AG AGA, GAG Arg, Glu AAG AGA, AAG, GAA Lys, Arg, Glu AGG is known to code for arginine. Taking into account the wobble hypothesis, assign each of the four codons produced in the experiment to its correct amino acid.
It is conceivable for codons encoding a single amino acid to share the first two bases while differing in the third. Why does this experimental finding support the idea of wobble?
Chapter 13 Solutions
Concepts of Genetics (12th Edition)
Ch. 13 - In a mixed heteropolymer experiment using...Ch. 13 - When repeating copolymers are used to form...Ch. 13 - The following represent deoxyribonucleotide...Ch. 13 - Prob. 1CSCh. 13 - A 30-year-old woman was undergoing therapy for...Ch. 13 - A 30-year-old woman was undergoing therapy for...Ch. 13 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 13 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 13 - Assuming the genetic code is a triplet, what...Ch. 13 - The mRNA formed from the repeating tetranucleotide...
Ch. 13 - In studies using repeating copolymers, AC ......Ch. 13 - In a coding experiment using repeating copolymers...Ch. 13 - Prob. 7PDQCh. 13 - When the amino acid sequences of insulin isolated...Ch. 13 - Prob. 9PDQCh. 13 - Why doesnt polynucleotide phosphorylase (Ochoas...Ch. 13 - Refer to Table 13.1. Can you hypothesize why a...Ch. 13 - Predict the amino acid sequence produced during...Ch. 13 - A short RNA molecule was isolated that...Ch. 13 - A glycine residue is in position 210 of the...Ch. 13 - Refer to Figure 13.7 to respond to the following:...Ch. 13 - Most proteins have more leucine than histidine...Ch. 13 - Define the process of transcription. Where does...Ch. 13 - Prob. 18PDQCh. 13 - Describe the structure of RNA polymerase in...Ch. 13 - Prob. 20PDQCh. 13 - Messenger RNA molecules are very difficult to...Ch. 13 - Present an overview of various forms of...Ch. 13 - One form of posttranscriptional modification of...Ch. 13 - Describe the role of two forms of RNA editing that...Ch. 13 - Substitution RNA editing is known to involve...Ch. 13 - Prob. 26ESPCh. 13 - Prob. 27ESPCh. 13 - Prob. 28ESPCh. 13 - Shown here are the amino acid sequences of the...Ch. 13 - The genetic code is degenerate. Amino acids are...Ch. 13 - M. Klemke et al. (2001) discovered an interesting...Ch. 13 - Recent observations indicate that alternative...Ch. 13 - Isoginkgetin is a cell-permeable chemical isolated...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A glycine residue is in position 210 of the tryptophan synthetase enzyme of wild-type E. coli. If the codon specifying glycine is GGA, how many single-base substitutions will result in an amino acid substitution at position 210? What are they? How many will result if the wild-type codon is GGU?arrow_forwardAccording to wobble rules, what codons should be recognized by the following anticodons? What amino acid residues do these correspond to?(a) 5′ ¬ICC ¬ 3′ (b) 5′ ¬GCU ¬3′arrow_forwardConsider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?arrow_forward
- Using a table that shows which codon represents which amino acid determine the following: A) The possible codons that encode Serine: B) The amino acids that could be encoded if the 2nd position of the UCA codon that encodes Serine was changed to one of the other 3 bases: C) The amino acids that could be encoded if the 3rd position of the UCA codon that encodes Serine was changed to one of the other 3 bases: D) The amino acids that could be encoded if the 1st position of the UCA codon that encodes Serine was changed to one of the other 3 bases:arrow_forwardIn prokaryotic protein synthesis, formylmethionine (fmet) is the first amino acid incorporated, whereas (normal) methionine is incorporated in eukaryotes. The same codon (AUG) serves both. What prevents methionine from being inserted into the beginning and formylmethionine in the interior?arrow_forwardShown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?arrow_forward
- Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code tablearrow_forwardDetermine the sequence of amino acids specified by the codons in the following information strand. AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC САА Then determine the sequence of amino acids if an insertion occurred to the left of the first adenosine and changed the reading frame as shown below. Notice that (1) the insertion is shown on the left by the lower-case “i", and (2) the bases are still in the same sequence; they are just shifted so that they are read differently. IAG GTC TTC AGG GAA TGC СTG GCG AGA GGG GAG CAG СTG GTA TCG CTG GGC CCA Suppose a single-nucleotide polymorphism occurred in the original strand to make the change shown below. Would this affect the resulting protein? Explain. This is the original strand AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC CAA This is the strand with the SNP. (The change is shown in red.) AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TAG TAT CGC TGG GCC САА Suppose a different single-nucleotide…arrow_forwardDetermine the sequence of amino acids specified by the codons in the following information strand. AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC САА Then determine the sequence of amino acids if an insertion occurred to the left of the first adenosine and changed the reading frame as shown below. Notice that (1) the insertion is shown on the left by the lower-case "i", and (2) the bases are still in the same sequence; they are just shifted so that they are read differently. IAG GTC TTC AĞG GAA TGC CTG GCG AGA GGG GAG CAG СTG GTA TCG CTG GGC ССАarrow_forward
- A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double-stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2). Solve, (b) Determine the amino acid sequence of each peptide.arrow_forwardThe concentration of RNase that Christian Anfinsen used in his denaturation/renaturation experiments was about 1 mg/ml. Inside the cell, the protein concentration is estimated to be more than 100 mg/ml. Predict the outcome of Anfinsen's experiments had he used a 100 mg/ml RNase concentration.arrow_forwardThere are four codons that encode threonine. Consider the leader sequence in Figure 31.22A. What codons are used and with what frequency?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license