Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 13, Problem 25PDQ
Substitution RNA editing is known to involve either C-to-U or A-to-I conversions. What common chemical event accounts for each?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Explain TWO (2) differences between two commonly used ligases; F. coli DNA ligase and
T4 DNA ligase.
When the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were
obtained:
Tetranucleotide
Hexanucleotide
Nonanucleotide
Decanucleotide
Dodenucleotide
Octadecanucleotide
Nonadecanucleotide
21-nucleotide
6c. What is the sequence of the bases in the mRNA coding for the peptide above?
The
The following sequence of nucleotides is found in a single-stranded DNA template:
ATTGCCAGATCATCCCAATAGAT
Assume that RNA polymerase proceeds along this template from left to right.
Q.Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
Chapter 13 Solutions
Concepts of Genetics (12th Edition)
Ch. 13 - In a mixed heteropolymer experiment using...Ch. 13 - When repeating copolymers are used to form...Ch. 13 - The following represent deoxyribonucleotide...Ch. 13 - Prob. 1CSCh. 13 - A 30-year-old woman was undergoing therapy for...Ch. 13 - A 30-year-old woman was undergoing therapy for...Ch. 13 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 13 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 13 - Assuming the genetic code is a triplet, what...Ch. 13 - The mRNA formed from the repeating tetranucleotide...
Ch. 13 - In studies using repeating copolymers, AC ......Ch. 13 - In a coding experiment using repeating copolymers...Ch. 13 - Prob. 7PDQCh. 13 - When the amino acid sequences of insulin isolated...Ch. 13 - Prob. 9PDQCh. 13 - Why doesnt polynucleotide phosphorylase (Ochoas...Ch. 13 - Refer to Table 13.1. Can you hypothesize why a...Ch. 13 - Predict the amino acid sequence produced during...Ch. 13 - A short RNA molecule was isolated that...Ch. 13 - A glycine residue is in position 210 of the...Ch. 13 - Refer to Figure 13.7 to respond to the following:...Ch. 13 - Most proteins have more leucine than histidine...Ch. 13 - Define the process of transcription. Where does...Ch. 13 - Prob. 18PDQCh. 13 - Describe the structure of RNA polymerase in...Ch. 13 - Prob. 20PDQCh. 13 - Messenger RNA molecules are very difficult to...Ch. 13 - Present an overview of various forms of...Ch. 13 - One form of posttranscriptional modification of...Ch. 13 - Describe the role of two forms of RNA editing that...Ch. 13 - Substitution RNA editing is known to involve...Ch. 13 - Prob. 26ESPCh. 13 - Prob. 27ESPCh. 13 - Prob. 28ESPCh. 13 - Shown here are the amino acid sequences of the...Ch. 13 - The genetic code is degenerate. Amino acids are...Ch. 13 - M. Klemke et al. (2001) discovered an interesting...Ch. 13 - Recent observations indicate that alternative...Ch. 13 - Isoginkgetin is a cell-permeable chemical isolated...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What basal transcription factor unwinds the DNA during transcription initiation? Aside from transcription, this factor also participates in nucleotide excision repair (NER). [name] [Note: Only the accurate abbreviation as used in class will be scored as correct. Note that protein names are in UPPER CASE.]arrow_forwardWhat is reverse transcription simple definition?arrow_forwardIn studies of the amino acid sequence of wild-type and mutant forms of tryptophan synthetase in E. coli, the following changes have been observed: Determine a set of triplet codes in which only a single-nucleotide change produces each amino acid change.arrow_forward
- A doctoral student in biology, Esther Mensah, is reviewing primary literature over RNAi interference as part of her literary research for her proposal on decreasing the amount of abnormal white blood cell growth associated with acute myeloid leukemia (AML) using a murine (mouse) model. She is being provided with 10 AML mice courtesy of her mentor. Can you help her out with her proposal? 1) Esther’s eventual goal is to design 20-26 bp RNA pieces that can bind to mRNA of AML and test it in a murine model. Of the choices below, which seems like the first step necessary to get her research off the ground? a) Make sure there is similarity between the murine AML gene and the human AML gene using a Clustal Omega alignment. b) BLAST the human version of the AML gene in NCBI. c) First, see if there is an existing mouse AML gene accession on NCBI to work with since that would negate the necessity to produce her own saving much time and money. d) Design the RNAi she will use for…arrow_forwardWhat is substitution RNA editing ?arrow_forwardTransfer RNA in eukaryotic cells is synthesized by which of the following enzymes (sensitive to high concentrations of the fungal poison a-amanitin, but not to low concentrations)? RNA polymerase I DNA polymerase I RNA polymerase II DNA polymerase II RNA polymerase IIIarrow_forward
- please list all possible products in a sequencing reaction using ddGTPA as a terminator based on the following sequences of a template : 3'-GGGCTATACCTGACCCTC-5'arrow_forwardA doctoral student in biology, Esther Mensah, is reviewing primary literature over RNAi interference as part of her literary research for her proposal on decreasing the amount of abnormal white blood cell growth associated with acute myeloid leukemia (AML) using a murine (mouse) model. She is being provided with 10 AML mice courtesy of her mentor. Can you help her out with her proposal? 1) Given her knowledge of RNAi, what type of RNA will Esther use to target the murine AML gene? a piRNA. b circRNA. c lncRNA. d siRNA. 2) In order for Esther’s RNAi to work, the small RNA pieces have to interact with another molecule. What molecule does she hope it will bind to? a DUH! It will bind to the DNA strands of the AML gene and knock it out! b It will bind to tRNA, which will block attachment of the amino acids needed to make the AML protein. c It will bind to circRNA, which will increase its longevity. d It will bind to the…arrow_forwardWhat is the advantage of homology-directed repair (HDR) ?arrow_forward
- A microbiologist discovers a new type II restriction endonuclease. When DNA is digested by this enzyme, fragments that average 1,048,500 bp in length are produced. What is the most likely number of base pairs in the recognition sequence of this enzyme?arrow_forwardFor each of the following sequences, rank them in order (from best to worst) as sequences that could be used to initiate translation according to Kozak’s rules. GACGCCAUGG GCCUCCAUGC GCCAUCAAGG GCCACCAUGGarrow_forwardCould a single nucleotide deletion restore the function of a protein-coding gene interrupted by the insertion of a 4-nt sequence? Explain.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
USMLE-Rx Antimicrobial Therapy; Author: USMLE-Rx;https://www.youtube.com/watch?v=Pka1Ynlrqtw;License: Standard Youtube License