Life: The Science of Biology
11th Edition
ISBN: 9781319010164
Author: David E. Sadava, David M. Hillis, H. Craig Heller, Sally D. Hacker
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 11.3, Problem 2R
Summary Introduction
To review:
The different levels of packing of the linear DNA during the prophase.
Introduction:
The human DNA (deoxyribonucleic acid) is around 2 meters long if put end to end, but it fits inside a very small nucleus. This is achieved by extensive packing of the DNA. This packing is done with the help of positively charged proteins that are known as the histones. The histone proteins contain a high amount of arginine and lysine residues.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
How many nucleosomes form the “width” of the 300 Angstrom fiber, in chromatin packaging?
what are we looking at in part (b)? Is this an11-nm fiber, a 30-nm fiber, or a 300-nm fiber? Does this DNAcome from a cell during M phase or interphase?
Forming nucleosomes and wrapping them into a 30-nm fiber provide part of the compaction of DNA in chromatin. If the fiber contains about six nucleosomes per 10 nm of length, what is the approximate compaction ratio achieved?
Chapter 11 Solutions
Life: The Science of Biology
Ch. 11.1 - Prob. 1RCh. 11.1 - Prob. 2RCh. 11.1 - Prob. 3RCh. 11.2 - Prob. 1RCh. 11.2 - Prob. 2RCh. 11.2 - Prob. 3RCh. 11.2 - Prob. 4RCh. 11.3 - Prob. 1RCh. 11.3 - Prob. 2RCh. 11.3 - Prob. 3R
Ch. 11.3 - Prob. 4RCh. 11.3 - Prob. 5RCh. 11.4 - Prob. 1RCh. 11.4 - Prob. 2RCh. 11.4 - Prob. 3RCh. 11.4 - Prob. 4RCh. 11.5 - Prob. 1RCh. 11.5 - Prob. 2RCh. 11.5 - Prob. 3RCh. 11.5 - Prob. 4RCh. 11.6 - Prob. 1RCh. 11.6 - Prob. 2RCh. 11.6 - Prob. 3RCh. 11.7 - Prob. 1RCh. 11.7 - Prob. 2RCh. 11.7 - Prob. 3R
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardWhat is the difference between euchromatin and heterochromatin?arrow_forwarda) One DNA strand of Chromosome #12 has the following nucleotide sequence: TAC/CGC/CCT. What nitrogenous bases would be found on "the other DNA strand lying alongside of it?" b) Which nitrogenous bases would be found on the MRNA (Messenger RNA) transcribed from a DNA strand with the following nucleotide sequence: AAA/TTT/GGG/CCC?arrow_forward
- Why Heterochromatin spreads linearly?arrow_forwardDuring the resolution of the two Holliday junctions, how many strands of DNA in total are broken during this process? Does the number differ depending on if this leads to recombination or non-recombination?”arrow_forwardWhat is constitutive heterochromatin?arrow_forward
- A part of a sequenced chromosome has the sequence (on one strand)ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG. Which part of thissequence is most likely to take up the Z conformation?arrow_forwardAssuming that the 30-nm chromatin fiber con-tains about 20 nucleosomes (200 bp/nucleosome) per 50nm of length, calculate the degree of compaction of DNAassociated with this level of chromatin structure. Whatfraction of the 10,000-fold condensation that occurs atmitosis does this level of DNA packing represent?arrow_forwardHelicases are crucial to many of the molecular biological processes we have learned about in this class. Briefly (2-3 sentences max), describe what a helicase does and give 2 examples of different processes (replication, repair, transcription, and translation) that helicases are involved in what it does in each process. A) What does a helicase do? B) Example 1 C) Example 2arrow_forward
- Mammals contain a diploid genome consisting of at least 109 bp. If this amount of DNA is present as chromatin fibers, where each group of 200 bp of DNA is combined with 9 histones into a nucleosome and each group of 6 nucleosomes is combined into a solenoid, achieving a final packing ratio of 50, determine (a) the total number of nucleosomes in all fibers, (b) the total number of histone molecules combined with DNA in the diploid genome, and (c) the combined length of all fibers.arrow_forwardWhat is the diameter of a nucleosome?arrow_forwardIf a human nucleus is 10 mm in diameter, and it must hold as much as 2 m of DNA, which is complexed into nucleosomes that during full extension are 11 nm in diameter, what percentage of the volume of the nucleus is occupied by the genetic material?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license