Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 10.L1, Problem 10MCQ
Summary Introduction
Introduction:
Transcription is the process by which RNA is synthesized using DNA as the template. Translation is the process by which the code in mRNA is used to make polypeptides.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Multiple Matching. Match the term with its description.___________nucleic acid probe___________nontemplate strand___________template strand___________reverse transcriptase___________Taq polymerase
___________RNAi___________primer___________restriction endonucleasea. enzyme that transcribes RNA into DNAb. complementary strand that blocks mRNA expressionc. the nontranslated strand of DNA or RNAd. enzyme that snips DNA at palindromese. oligonucleotide that initiates the PCRf. strand of nucleic acid that is transcribed or translatedg. thermostable enzyme for synthesizing DNAh. oligonucleotide used in hybridization
B. Restriction Mapping. Single and double digestion of plasmid pMCS326 were performed using the
restriction enzymes Alulll and EcoRV. DNA fragments are shown in an electrophoretogram below.
Construct a restriction map of plasmid pMCS326 for enzymes Alulll and EcoRV.
20 kb
11 kb
8 kb
6 kb
kb
3
Alulll +
Alull EcoRV ECORV
| ||
Restriction Map:
U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions.
PscI & GsuI
______________________________________________________________
ScaI, PdmI & BsaXI
______________________________________________________________
ScaI, SspI & EheI
______________________________________________________________
Chapter 10 Solutions
Foundations in Microbiology
Ch. 10.1 - Define genetic engineering, and describe some of...Ch. 10.1 - Explain the properties of DNA that lend to its...Ch. 10.1 - Summarize the major methods of analyzing DMA and...Ch. 10.1 - Describe the technology behind Identifying,...Ch. 10.1 - Define genetic engineering and biotechnology, and...Ch. 10.1 - Describe the processes involved in denaturing and...Ch. 10.1 - Define restriction endonuclease and explain what...Ch. 10.1 - Prob. 4CYPCh. 10.1 - Explain how electrophoresis works and the general...Ch. 10.1 - How would you make a copy of DNA from an mRNA...
Ch. 10.1 - Briefly summarize the steps involved in DNA...Ch. 10.1 - Outline the steps in the PCR technique and...Ch. 10.1 - What are the functions of primer and Taq...Ch. 10.2 - Explain what is involved in recombinant DNA...Ch. 10.2 - Characterize the events in cloning, using an...Ch. 10.2 - List and discuss some protein products of...Ch. 10.2 - What characteristics of plasmids and...Ch. 10.2 - Name several types of vectors, and list the types...Ch. 10.2 - Describe the basic principles behind recombinant...Ch. 10.2 - Summarize the characteristics of bacteria and...Ch. 10.2 - Outline the main steps in cloning a gene,...Ch. 10.2 - What is one way to determine whether a bacterial...Ch. 10.2 - Characterize several products that have resulted...Ch. 10.3 - Define what is meant by the term transgenic or...Ch. 10.3 - Describe the uses of genetically modified bacteria...Ch. 10.3 - Prob. 10ELOCh. 10.3 - Explain how DNA technology can be used to treat...Ch. 10.3 - Describe several uses of genetically modified...Ch. 10.3 - Prob. 18CYPCh. 10.3 - Why must animals usually be modified in the embryo...Ch. 10.3 - Prob. 20CYPCh. 10.3 - What are some ethical and biological...Ch. 10.3 - Outline the uses of gene therapy and gene editing...Ch. 10.4 - Outline the uses of gene therapy and gene editing...Ch. 10.4 - Describe two methods in performing a DNA analysis,...Ch. 10.4 - Describe several applications of DNA profiling and...Ch. 10.4 - Describe what a DNA profile is and how STRs and...Ch. 10.4 - Prob. 24CYPCh. 10.4 - Explain the origins of mtDNA and its importance in...Ch. 10.4 - Explain the difference between a DNA profile and a...Ch. 10.L1 - Which gene is incorporated into plasmids to detect...Ch. 10.L1 - Which of the following is not essential to carry...Ch. 10.L1 - Which of the following is not a part of the Sanger...Ch. 10.L1 - The function of ligase is to a. rejoin segments of...Ch. 10.L1 - The pathogen of plant roots that is used as a...Ch. 10.L1 - Prob. 6MCQCh. 10.L1 - Which DNA fragment will be closest to the top...Ch. 10.L1 - Prob. 8MCQCh. 10.L1 - For which of the following would not require a...Ch. 10.L1 - Prob. 10MCQCh. 10.L1 - What type of mutation caused Nicholas’s disease?...Ch. 10.L1 - Which type of cells were used to extract the DNA...Ch. 10.L1 - Lay out the genetics of Nicholas’s case,...Ch. 10.L1 - Prob. 1WCCh. 10.L1 - What is it about the endonucleases that prevents...Ch. 10.L1 - Prob. 3WCCh. 10.L1 - a. Explain what hybridization is and how it is...Ch. 10.L1 - Prob. 5WCCh. 10.L1 - Prob. 6WCCh. 10.L1 - Prob. 7WCCh. 10.L1 - Explain the kinds of study involved in genomics,...Ch. 10.L1 - For what reasons would gene therapy be more...Ch. 10.L1 - Prob. 10WCCh. 10.L2 - a. Give an example of a benefit of genetic...Ch. 10.L2 - a. When gene probes, DNA profiling, and sequencing...Ch. 10.L2 - Which suspect is the likely perpetrator according...Ch. 10.L2 - Trace the genetic steps in the development of a...Ch. 10.L2 - You are on a jury to decide whether a person...Ch. 10.L2 - Can you think of some reasons it would not be...Ch. 10.L2 - What would be some major impediments to...Ch. 10.L2 - Prob. 8CTCh. 10.L2 - Describe the main differences between genome...Ch. 10.L2 - Itemize all of the ways that microbes have...Ch. 10.L2 - Below are two unrelated DNA paternity tests: one...Ch. 10.L2 - Figure 9.25d, shown here, shows the original...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- | Choose ) [Choose ) electroporation restriction fragments sticky end expression vectorarrow_forwardDrag and drop the appropriate text in the gaps below. Firstly, the plasmid DNA in the E. coli is propagated through Then the bacterial cells are pelleted by centrifugation at 10,000 RPM. The media supernatant is removed and the bacterial cells are The bacterial cells are then lysed via |. Contaminating macromolecules such as protein and chromosomal DNA is removed by Overnight incubation of the bacterial culture washed in cell resuspension buffer addition of lysis buffer addition of neutralisation buffer washing of the spin column separation via agarose gel electrophoresisarrow_forwardWhat is the point of DNA replication? ____________________________ When & where does replication occur? _____________________________ What is the point of transcription? _______________________________ Where does it occur? _____________________________ What are three nucleotides together called on mRNA? (ie: ACA)__________ The mRNA codons can be used in a chart to find: ____________________ What molecule contains an anti-codon? ______________________ During what process is it used? _________________________ Translation takes place in a ________________. __________________ and ___________________ make up ribosomes. What is the point of translation? Transcription and translation together is the process of ________________ _______________.arrow_forward
- DNA Replication Terms _____DNA polymerase III _____Primase _____Helicase _____Lagging Strand _____Leading Strand _____RNA Primer _____Single Strand Binding Protein _____5’ _____3’ _____DNA Ligase _____ Topoisomerase _____Template Strand _____Coding Strandarrow_forward________________ "cut" DNA at specific sequences and the resulting segment with sticky ends is "pasted" into a plasmid by ___________ to then be replicated in the host. Group of answer choices 1. Restriction enzymes; ethidium bromide 2 DNA polymerases; ligase 3 Restriction enzymes; ligase 4 Ligases; restriction enzymesarrow_forwardRestriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately. 5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’arrow_forward
- biotechnology lab class :1. The bacterial streaking on antibiotic containing agar plates has been completed and the plates will be available for you to inspect in the lab class.2. You will complete a restriction enzyme digest on the four available plasmid stocks and then examine the products by agarose gel electrophoresis. Photographs of the gel are attached to identify the plasmid present in each analysed sample.Now consider the following questions :- For each of the four plasmids used in the practical, identify the size (in kb) of the linear DNA fragment(s) that you would expect to obtain if the EcoRI digest is complete.- Using the provided negative image of the gel, which shows the bands present in the ND and D samples for each plasmid, identify the plasmid that was present in each of the four plasmid stock.- Explain how you were able to identify plasmid in each sample using the gel, considering how linear DNA fragments of different length are separated by agarose gel…arrow_forwardprofile-image If you take a DNA photolyase- strain of E. coli, and subject it to the treatment below step 1, spread evenly on LB plate step 2, subject to UV light step 3, cover half of plate and grow in light What will be the most likely outcome if the level of UV is nearly lethal to cells on the plate? a. Only colonies on uncovered side of plate b. Only colonies on covered side of plate c. very few colonies in roughly equal numbers on both sides of platearrow_forwardA ____________ is required to transfer DNA sequences from one organism to another. reporter gene vector genetic probe restriction endonuclease genomic libraryarrow_forward
- Which statement is NOT the function of restriction enzyme? Group of answer choices It cuts the vector’s plasmid and the desired gene from the original DNA. It ligates the desired to gene to vector’s plasmid. It acts as scissors of DNA that cut along a specific sequence. It serves as degrading proteins that cut plasmid on specific target site.arrow_forwardFor each of the following, give a brief description of the purpose and give an application Restriction enzymes Plasmids Gel Electrophoresis PCRarrow_forwardElectrophoresis data: Measure the distance (in millimeters) that each fragment traveled from the well and record it in the tabie. Estimate its size, in base pairs, by comparing its position to the Hindll lambda DNA markers. Remember: some lanes will have fewer than 6 fragments. H = Hindll Largest fragment first P Pstl E = EcoRI L = lambda DNA- no restriction digest restriction digest restriction digest of lambda DNA M = DNA marker of lambda DNA enzyme of lambda DNA Estmated base pairs Distance in mm Estimated base pairs Distance in mm Estimated base pa rs Distance inmm Estimated base pairs Dislance Distance in mm Actual base pairs 5 mm 58 mm 54 nm 26.5m 23.130 49m Band 1 69 mm 32. 96 Mm Band 2 9.416 39 hm 120mm 87 mM Band 3 6.557 41 mm 127m 1.00mm Band 4 4.361 1.08m Band 5 2,322 1482m 65mm 2,027 Band 6 Step 3. Now using the standard curve you created in the pre-lab exercises and the distances you measured above, predict the sizes of each fragment based on the distances traveled by…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY