Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 10.L1, Problem 6MCQ
Summary Introduction
Introduction:
Restriction endonucleases are enzymes that cut
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Choose the combination of answers that most accurately completes the statement.Which of the following sequences, when combined with its complement, would be clipped by a restriction endonuclease? a. ATCGATCGTAGCTA c. GAATTC b. AAGCTTCGAA d. ACCATTGGA
HindIII is a restriction endonuclease that recognizes a palindrome sequence. Predict which one is the HindIII recognition site:
a.
AAGGTT
b.
AAGCTT
c.
AGCCGA
d.
AGCGCA
e.
AGCAGC
Why would you NOT expect a restriction endonuclease to exist that would recognize the site AAGGAA?
Chapter 10 Solutions
Foundations in Microbiology
Ch. 10.1 - Define genetic engineering, and describe some of...Ch. 10.1 - Explain the properties of DNA that lend to its...Ch. 10.1 - Summarize the major methods of analyzing DMA and...Ch. 10.1 - Describe the technology behind Identifying,...Ch. 10.1 - Define genetic engineering and biotechnology, and...Ch. 10.1 - Describe the processes involved in denaturing and...Ch. 10.1 - Define restriction endonuclease and explain what...Ch. 10.1 - Prob. 4CYPCh. 10.1 - Explain how electrophoresis works and the general...Ch. 10.1 - How would you make a copy of DNA from an mRNA...
Ch. 10.1 - Briefly summarize the steps involved in DNA...Ch. 10.1 - Outline the steps in the PCR technique and...Ch. 10.1 - What are the functions of primer and Taq...Ch. 10.2 - Explain what is involved in recombinant DNA...Ch. 10.2 - Characterize the events in cloning, using an...Ch. 10.2 - List and discuss some protein products of...Ch. 10.2 - What characteristics of plasmids and...Ch. 10.2 - Name several types of vectors, and list the types...Ch. 10.2 - Describe the basic principles behind recombinant...Ch. 10.2 - Summarize the characteristics of bacteria and...Ch. 10.2 - Outline the main steps in cloning a gene,...Ch. 10.2 - What is one way to determine whether a bacterial...Ch. 10.2 - Characterize several products that have resulted...Ch. 10.3 - Define what is meant by the term transgenic or...Ch. 10.3 - Describe the uses of genetically modified bacteria...Ch. 10.3 - Prob. 10ELOCh. 10.3 - Explain how DNA technology can be used to treat...Ch. 10.3 - Describe several uses of genetically modified...Ch. 10.3 - Prob. 18CYPCh. 10.3 - Why must animals usually be modified in the embryo...Ch. 10.3 - Prob. 20CYPCh. 10.3 - What are some ethical and biological...Ch. 10.3 - Outline the uses of gene therapy and gene editing...Ch. 10.4 - Outline the uses of gene therapy and gene editing...Ch. 10.4 - Describe two methods in performing a DNA analysis,...Ch. 10.4 - Describe several applications of DNA profiling and...Ch. 10.4 - Describe what a DNA profile is and how STRs and...Ch. 10.4 - Prob. 24CYPCh. 10.4 - Explain the origins of mtDNA and its importance in...Ch. 10.4 - Explain the difference between a DNA profile and a...Ch. 10.L1 - Which gene is incorporated into plasmids to detect...Ch. 10.L1 - Which of the following is not essential to carry...Ch. 10.L1 - Which of the following is not a part of the Sanger...Ch. 10.L1 - The function of ligase is to a. rejoin segments of...Ch. 10.L1 - The pathogen of plant roots that is used as a...Ch. 10.L1 - Prob. 6MCQCh. 10.L1 - Which DNA fragment will be closest to the top...Ch. 10.L1 - Prob. 8MCQCh. 10.L1 - For which of the following would not require a...Ch. 10.L1 - Prob. 10MCQCh. 10.L1 - What type of mutation caused Nicholas’s disease?...Ch. 10.L1 - Which type of cells were used to extract the DNA...Ch. 10.L1 - Lay out the genetics of Nicholas’s case,...Ch. 10.L1 - Prob. 1WCCh. 10.L1 - What is it about the endonucleases that prevents...Ch. 10.L1 - Prob. 3WCCh. 10.L1 - a. Explain what hybridization is and how it is...Ch. 10.L1 - Prob. 5WCCh. 10.L1 - Prob. 6WCCh. 10.L1 - Prob. 7WCCh. 10.L1 - Explain the kinds of study involved in genomics,...Ch. 10.L1 - For what reasons would gene therapy be more...Ch. 10.L1 - Prob. 10WCCh. 10.L2 - a. Give an example of a benefit of genetic...Ch. 10.L2 - a. When gene probes, DNA profiling, and sequencing...Ch. 10.L2 - Which suspect is the likely perpetrator according...Ch. 10.L2 - Trace the genetic steps in the development of a...Ch. 10.L2 - You are on a jury to decide whether a person...Ch. 10.L2 - Can you think of some reasons it would not be...Ch. 10.L2 - What would be some major impediments to...Ch. 10.L2 - Prob. 8CTCh. 10.L2 - Describe the main differences between genome...Ch. 10.L2 - Itemize all of the ways that microbes have...Ch. 10.L2 - Below are two unrelated DNA paternity tests: one...Ch. 10.L2 - Figure 9.25d, shown here, shows the original...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The restriction enzyme Haelll has the recognition sequence below and cuts between the G and C bases. 5'...GG'CC...3' 3...CC'GG...5' Determine the number of fragments that would be produced with the following sequence. 5'-ATTGCGCTCAAAGGCCAATCATCAGGTTC-3' 3'-TAACGCGAGTTTCCGGTTAGTAGTCCAAG-5' O 1 O 2 O 3 O 4 MacBook Prarrow_forwardThe following is a section of the gene coding for bovine rhodopsin along with several restriction endonucleases, their recognition sequences, and their hydrolysis sites. Which endonucleases will catalyze cleavage of this section of DNA? 5-GCCGTCTACAАСССGGTCATCTAАСТАТСАТGATCААСАAGCAGTTCCGGAACT-3' Recognition Sequence Recognition Sequence Enzyme Enzyme AG | CT TGG | CCA CG I CG GG | CC CI CGG | GATC GC | GGCCGC GAGCT | C Alul Hpall Ball Mbol FnuDII NotI HealII Sadarrow_forwardWhat restriction enzyme (or enzymes) would you use to cut the following... (Gene of Interest is Bolded) 1 tctagagtca tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg…arrow_forward
- This is a restriction map for the 250 base pair plasmid pSage. Restriction sites for the restriction endonuclease Nhel are 7, 69 and 160. What are the sizes of the restriction fragments produced? Check all that apply. p SAGE Nhel 7 250 bp Nhền 160 Nhel 69 62 69 91 160 97arrow_forwardRestriction sites are palindromic; that is, they read the same in the5' to 3' direction on each strand of DNA. What is the advantage ofhaving restriction sites organized this way?arrow_forwardFor a restriction enzyme that recognizes the restriction site GGCC, Which of the following statements is/are true?arrow_forward
- Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’ 5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’arrow_forwardDo eukaryotic cells have restriction endonucleases? Justify your answer.arrow_forwardDefine the following terms: a. nonreplicative transposition b. transposable element c. bacterial transformation d. transduction e. conjugationarrow_forward
- Define about Alu family (the name is based on the presence of DNA sequences recognized by the restriction endonuclease AluI)arrow_forwardA new restriction enzyme is discovered. It recognizes a 6 base pair pallindromic sequence. The first three bases of the target sequence are are given below with the cut identified by ^. Answer the following questions: Target sequence: 5' G^TA _ _ _ 3'3' _ _ _ _ _ _ 5' 1) Complete the target sequence with all missing bases. Also include the position of the cut in the lower sequence(^) 2) What kind of clevage does the enzyme use?arrow_forwardIf restriction endonucleases are produced by bacteria within a host, why don’t these enzymes chew up the genomic DNA of their host? What is the role of DNA methyltransferase in this? Indicate the answerarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY