Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 10.L1, Problem 1CSR
What type of mutation caused Nicholas’s disease?
a. frameshift
b. missense
c. nonsense
d. insertion
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
which of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply
a. Thread-like blood vessels in eyes
b. Excessive bleeding
c. Dwarfism
d. UV light sensitivity
e. sunburn
f. Bruises
What kind of mutation normally has no consequence?
please explain the answer
a.transversions
b.insertion
c.silent
d.nonsense
after a successful infection by a viral particle, it integrates its genome into the host DNA. which term best describe the change of host genome?
a. none
b.silent mutation
c.missense mutation
d.frame shift mutation
Chapter 10 Solutions
Foundations in Microbiology
Ch. 10.1 - Define genetic engineering, and describe some of...Ch. 10.1 - Explain the properties of DNA that lend to its...Ch. 10.1 - Summarize the major methods of analyzing DMA and...Ch. 10.1 - Describe the technology behind Identifying,...Ch. 10.1 - Define genetic engineering and biotechnology, and...Ch. 10.1 - Describe the processes involved in denaturing and...Ch. 10.1 - Define restriction endonuclease and explain what...Ch. 10.1 - Prob. 4CYPCh. 10.1 - Explain how electrophoresis works and the general...Ch. 10.1 - How would you make a copy of DNA from an mRNA...
Ch. 10.1 - Briefly summarize the steps involved in DNA...Ch. 10.1 - Outline the steps in the PCR technique and...Ch. 10.1 - What are the functions of primer and Taq...Ch. 10.2 - Explain what is involved in recombinant DNA...Ch. 10.2 - Characterize the events in cloning, using an...Ch. 10.2 - List and discuss some protein products of...Ch. 10.2 - What characteristics of plasmids and...Ch. 10.2 - Name several types of vectors, and list the types...Ch. 10.2 - Describe the basic principles behind recombinant...Ch. 10.2 - Summarize the characteristics of bacteria and...Ch. 10.2 - Outline the main steps in cloning a gene,...Ch. 10.2 - What is one way to determine whether a bacterial...Ch. 10.2 - Characterize several products that have resulted...Ch. 10.3 - Define what is meant by the term transgenic or...Ch. 10.3 - Describe the uses of genetically modified bacteria...Ch. 10.3 - Prob. 10ELOCh. 10.3 - Explain how DNA technology can be used to treat...Ch. 10.3 - Describe several uses of genetically modified...Ch. 10.3 - Prob. 18CYPCh. 10.3 - Why must animals usually be modified in the embryo...Ch. 10.3 - Prob. 20CYPCh. 10.3 - What are some ethical and biological...Ch. 10.3 - Outline the uses of gene therapy and gene editing...Ch. 10.4 - Outline the uses of gene therapy and gene editing...Ch. 10.4 - Describe two methods in performing a DNA analysis,...Ch. 10.4 - Describe several applications of DNA profiling and...Ch. 10.4 - Describe what a DNA profile is and how STRs and...Ch. 10.4 - Prob. 24CYPCh. 10.4 - Explain the origins of mtDNA and its importance in...Ch. 10.4 - Explain the difference between a DNA profile and a...Ch. 10.L1 - Which gene is incorporated into plasmids to detect...Ch. 10.L1 - Which of the following is not essential to carry...Ch. 10.L1 - Which of the following is not a part of the Sanger...Ch. 10.L1 - The function of ligase is to a. rejoin segments of...Ch. 10.L1 - The pathogen of plant roots that is used as a...Ch. 10.L1 - Prob. 6MCQCh. 10.L1 - Which DNA fragment will be closest to the top...Ch. 10.L1 - Prob. 8MCQCh. 10.L1 - For which of the following would not require a...Ch. 10.L1 - Prob. 10MCQCh. 10.L1 - What type of mutation caused Nicholas’s disease?...Ch. 10.L1 - Which type of cells were used to extract the DNA...Ch. 10.L1 - Lay out the genetics of Nicholas’s case,...Ch. 10.L1 - Prob. 1WCCh. 10.L1 - What is it about the endonucleases that prevents...Ch. 10.L1 - Prob. 3WCCh. 10.L1 - a. Explain what hybridization is and how it is...Ch. 10.L1 - Prob. 5WCCh. 10.L1 - Prob. 6WCCh. 10.L1 - Prob. 7WCCh. 10.L1 - Explain the kinds of study involved in genomics,...Ch. 10.L1 - For what reasons would gene therapy be more...Ch. 10.L1 - Prob. 10WCCh. 10.L2 - a. Give an example of a benefit of genetic...Ch. 10.L2 - a. When gene probes, DNA profiling, and sequencing...Ch. 10.L2 - Which suspect is the likely perpetrator according...Ch. 10.L2 - Trace the genetic steps in the development of a...Ch. 10.L2 - You are on a jury to decide whether a person...Ch. 10.L2 - Can you think of some reasons it would not be...Ch. 10.L2 - What would be some major impediments to...Ch. 10.L2 - Prob. 8CTCh. 10.L2 - Describe the main differences between genome...Ch. 10.L2 - Itemize all of the ways that microbes have...Ch. 10.L2 - Below are two unrelated DNA paternity tests: one...Ch. 10.L2 - Figure 9.25d, shown here, shows the original...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What type of mutation is represented in the second strand of DNA? 1. TACGGCACT2. TACGGAACT A. Insertion B. No Mutation C. Deletion D. Substitutionarrow_forwardWhat type of mutation is represented in the second strand of DNA? TACGGCACT TACGGCCACT answer choices A. Deletion B. Substitution C. No mutation D. Insertionarrow_forwardA retrotransposon does NOT contain genes for which polyprotein? a. gag b. pol c. It contains genes for all of these polyproteins d. envarrow_forward
- Which nucleic-acid based technique will detect norovirus? A. Fluorescent In Situ Hybridization (FISH) probes B. PCR with primers specific for the genome of this virus C. Terminal Restriction Fragment Length Polymorphism (T-RFLP) D. reverse transcription PCR with specific primers A patient's blood sample tests positive for the antigen to Vibrio cholerae. Which of the following interpretations is correct? A. This person has cholera. B. This person was exposed to any species of Vibrio. C. This person was exposed to V. cholerae recently. D. This person had cholera at some point in their lifetime.arrow_forwardWhich DNA polymerase in prokaryotes is involved in the replacement of primers with deoxynucleotides? a.DNA-Pol I b.DNA-Pol II c.DNA-Pol Ill d.DNA-Pol IVarrow_forward105) The Baltimore classification a. There were 4 classes for DNA families b. There were 6 classes in the original classification, he missed the dsRNA viruses. c. There were 6 classes in the original classification, he missed the retrovirus with RT enzyme d. The classification was based on how viruses produce their mRNAarrow_forward
- a mutation in dna that adds +1 ot -1 nucleotide or +2 or -2 nucleotides is called a______? (choose one answer only) A. frameshift mutation B. silent mutation C. nonsense mutation D. missense mutationarrow_forwardWhat type of mutation is shown in the figure below? A. frameshift, insertion D. frameshift, deletion B. point mutation, silent C. base substitution, missense Normal hemoglobin DNA ст mRNA TT ALL Normal hemoglobin Glu Mutant hemoglobin DNA C I AT mRNA GU Sickle-cell hemoglobin Valarrow_forwardWhich of the following mutations is NOT a point mutation? A. Missense mutation B. Insertion mutation C. Nonsense mutation D. Silent mutationarrow_forward
- A DNA nucleotide triplet that codes for the amino acid alanine is CCA b. CGG CCU d. CGU a. C.arrow_forwardIndividuals with Turner’s syndrome inherit what chromosomes? a. XX b. XO c. XXY d. XXX What is the complimentary base pair of the following DNA strand? AAT-TCG-GGC-TTA-ACT-CCA a. TTA-AGC-CCG-ATT-TGA-CGT b. TTA-AGC-CCG-AAT-TGA-GGT c. TTA-ACG-CCG-ATT-TGA-GCT d. TAA-AGC-CCG-AAT-TCA-GGTarrow_forwardWhich of the following results in the same amino acid in its protein sequence? a. missense mutation b. sense mutation c. nonsense mutation d. antisense mutationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY