Foundations in Microbiology
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 10.L1, Problem 1CSR

What type of mutation caused Nicholas’s disease?

a. frameshift

b. missense

c. nonsense

d. insertion

Blurred answer
Students have asked these similar questions
which of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity  e. sunburn  f. Bruises
What kind of mutation normally has no consequence? please explain the answer a.transversions b.insertion c.silent d.nonsense
after a successful infection by a viral particle, it integrates its genome into the host DNA. which term best describe the change of host genome? a. none b.silent mutation c.missense mutation d.frame shift mutation

Chapter 10 Solutions

Foundations in Microbiology

Ch. 10.1 - Briefly summarize the steps involved in DNA...Ch. 10.1 - Outline the steps in the PCR technique and...Ch. 10.1 - What are the functions of primer and Taq...Ch. 10.2 - Explain what is involved in recombinant DNA...Ch. 10.2 - Characterize the events in cloning, using an...Ch. 10.2 - List and discuss some protein products of...Ch. 10.2 - What characteristics of plasmids and...Ch. 10.2 - Name several types of vectors, and list the types...Ch. 10.2 - Describe the basic principles behind recombinant...Ch. 10.2 - Summarize the characteristics of bacteria and...Ch. 10.2 - Outline the main steps in cloning a gene,...Ch. 10.2 - What is one way to determine whether a bacterial...Ch. 10.2 - Characterize several products that have resulted...Ch. 10.3 - Define what is meant by the term transgenic or...Ch. 10.3 - Describe the uses of genetically modified bacteria...Ch. 10.3 - Prob. 10ELOCh. 10.3 - Explain how DNA technology can be used to treat...Ch. 10.3 - Describe several uses of genetically modified...Ch. 10.3 - Prob. 18CYPCh. 10.3 - Why must animals usually be modified in the embryo...Ch. 10.3 - Prob. 20CYPCh. 10.3 - What are some ethical and biological...Ch. 10.3 - Outline the uses of gene therapy and gene editing...Ch. 10.4 - Outline the uses of gene therapy and gene editing...Ch. 10.4 - Describe two methods in performing a DNA analysis,...Ch. 10.4 - Describe several applications of DNA profiling and...Ch. 10.4 - Describe what a DNA profile is and how STRs and...Ch. 10.4 - Prob. 24CYPCh. 10.4 - Explain the origins of mtDNA and its importance in...Ch. 10.4 - Explain the difference between a DNA profile and a...Ch. 10.L1 - Which gene is incorporated into plasmids to detect...Ch. 10.L1 - Which of the following is not essential to carry...Ch. 10.L1 - Which of the following is not a part of the Sanger...Ch. 10.L1 - The function of ligase is to a. rejoin segments of...Ch. 10.L1 - The pathogen of plant roots that is used as a...Ch. 10.L1 - Prob. 6MCQCh. 10.L1 - Which DNA fragment will be closest to the top...Ch. 10.L1 - Prob. 8MCQCh. 10.L1 - For which of the following would not require a...Ch. 10.L1 - Prob. 10MCQCh. 10.L1 - What type of mutation caused Nicholas’s disease?...Ch. 10.L1 - Which type of cells were used to extract the DNA...Ch. 10.L1 - Lay out the genetics of Nicholas’s case,...Ch. 10.L1 - Prob. 1WCCh. 10.L1 - What is it about the endonucleases that prevents...Ch. 10.L1 - Prob. 3WCCh. 10.L1 - a. Explain what hybridization is and how it is...Ch. 10.L1 - Prob. 5WCCh. 10.L1 - Prob. 6WCCh. 10.L1 - Prob. 7WCCh. 10.L1 - Explain the kinds of study involved in genomics,...Ch. 10.L1 - For what reasons would gene therapy be more...Ch. 10.L1 - Prob. 10WCCh. 10.L2 - a. Give an example of a benefit of genetic...Ch. 10.L2 - a. When gene probes, DNA profiling, and sequencing...Ch. 10.L2 - Which suspect is the likely perpetrator according...Ch. 10.L2 - Trace the genetic steps in the development of a...Ch. 10.L2 - You are on a jury to decide whether a person...Ch. 10.L2 - Can you think of some reasons it would not be...Ch. 10.L2 - What would be some major impediments to...Ch. 10.L2 - Prob. 8CTCh. 10.L2 - Describe the main differences between genome...Ch. 10.L2 - Itemize all of the ways that microbes have...Ch. 10.L2 - Below are two unrelated DNA paternity tests: one...Ch. 10.L2 - Figure 9.25d, shown here, shows the original...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY