Match the items on the diagram with the correct term below. 3' 5' 5 D 8 Activate W DNA Replication Terms
Q: 8. Structures of three coenzymes involved in Phase II conjugation reactions are shown below. For…
A: Coenzymes are organic nonprotein molecules that bind to the apoenzyme to form the active holoenzyme.…
Q: 3. (а) 0.0050 M operate at one-quarter of its maximum rate? At what substrate concentration would an…
A: To study an enzyme kinetics, Michaelis-Menten kinetics equation is best known mathematical…
Q: Determine whether the following monosaccharides have D or L configuration and classify them based on…
A: In the d/l system (named after Latin dexter and laevus) molecules are named relating them to the…
Q: Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation?…
A: Steps in Prokaryotic Translation Initiation: GTP bond Initiation factors (IF1-3) binds to 30S…
Q: What is the heterozygous advantage of people having sickle-cell trait in areas where malaria is a…
A: Introduction: Sickle cell anemia is an autosomal inherited blood disorder that affects hemoglobin…
Q: Answer the following multiple-choice questions and EXPLAIN in 3-5 sentences why you chose that…
A: Enzyme is basically biocatalyst that increase the rate of chemical reaction without itself being…
Q: In Metabolic Pathways, what are the nucleotide-containing compounds?
A: A nucleotide mainly consists of a sugar molecule that is either ribose in RNA or deoxyribose in DNA…
Q: In a single pass through of the b-oxidation pathway, what are products that can be used in a…
A: Introduction: The fatty acids present in our diet or produced through the degradation of…
Q: Renata enzymatically conjugates a "C-labeled cysteine to a transfer RNA (IRNA), with a UGU…
A: The genetic codon is the three letter codon that specifies the twenty naturally occurring amino…
Q: Explain the correlation between fasting and gluconeogenesis in terms of the hormone released by the…
A: From the non-carbohydrate source, glucose is synthesized called gluconeogenesis. It is a…
Q: Question 8 All of the following have terpene structure, except Cholecalciferol Squalene Carotenoids…
A: Terpenes generally are composed of two, three, four, or six isoprene units. Many important terpenes…
Q: what transport proteins are involved is getting ca2+ out of cytosol
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Why does picric acid and tannic acid are used to treat burn?
A: PICRIC ACID : Picric acid is an organic compound containing IUPAC name as TNP (2,4,6 tri nitro…
Q: Visceral fat loss is often associated with increased insulin sensitivity. Assuming that with the…
A: D. -10.6
Q: hosphate buffers are commonly used to mimic biological systems. Given that phosophoric acid is a…
A: Phosphate Buffer System consists or made up of:- Sodium Dihydrogen Phosphate & Disodium…
Q: 5. A young woman decided to lose weight and abstained from fat-containing food for several months.…
A: "Since you have asked multiple questions, we will solve the first three subparts of the question for…
Q: Given Sorbitol, Briefly explain its expected reaction (based on their structural formula) to the…
A: Sorbitol is a carbohydrate that is classified as a sugar alcohol or polyol.
Q: The table below provides kinetic information when ADH is reacted with ethanol alone, NAD+ alone, and…
A: Enzyme kinetics is the study of an enzyme catalyzed biochemical reactions. Usually it is studied by…
Q: Please identify whether the statements below is true or false. Thank you! (Please put a short…
A: Amino acids are compounds containing carbon, hydrogen, oxygen, and nitrogen. Proteins are polymers…
Q: What is the significance of the positioning of the amino acid side chains and alpha carbons as you…
A: Proteins are polymers of amino acids linked by peptide bond/amide bond. Peptide bond is a covalent,…
Q: Give the 3 major pathways that eventually become entry points of molecules into the Krebs Cycle.…
A: The Krebs cycle, or citric acid cycle, occurs in the mitochondrion of a cell. The citric acid cycle…
Q: ANSWER BRIEFLY EACH QUESTION 1. Why is confirmatory test important to perform in different drug of…
A: The question talks about different substance abuse compounds. Right after the screening of drugs the…
Q: Consider this intermediate in the derivation of the Michaelis-Menten equation. [E] [S] k-1 + k2 [ES|…
A: Km : The concentration of substrate at which enzyme achieves half Vmax-maximum velocity
Q: DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B |C| D Exons: A, C, D…
A: hnRNA is a heterogenous RNA , also called as pre mRNA formed by the enzyme called RNA pol 2 ,…
Q: Which statement best describes the Cori cycle? Group of answer choices It regenerates glucose from…
A: Cori cycle: This is the metabolic pathway in which lactate produced during anaerobic glycolysis is…
Q: 1. A farmer crossed a round-shaped (T) and yellow-colored (Y) seed plant carrying yellow seeds (Y)…
A: Given P1(Parent 1)= Round Shape(T) Yellow Colour (Y) P2(Parent 2)= Wrinkled Shape(t) Green Colour…
Q: Draw and label a structure of: A diglyceride of oleic acid
A: A diglyceride is composed of a glycerol molecule attached to two fatty acids through ester bonds.…
Q: What diseases are the related protein deficiency in the human body? Explain their rationale.
A: Protein deficiency occurs in the human body when the body does not get enough amount of protein that…
Q: How should you prepare your running buffer?
A: SDS-PAGE is method of separation of protein based on its size. Running buffer of the SDS-PAGE…
Q: How might a synthetic detergent be superior to a normal soap?
A: INTRODUCTION - Soaps are sodium or potassium fatty acid salts made from hydrolysis of fats in…
Q: Enzymes occasionally display weak "side" activities. Draw the structure of the product (other than…
A: Pyruvate is formed in the last step of glycolysis with release of one ATP per molecule, catalyzed by…
Q: find stereochemistry, (from the structure) , rotational bond and geometrical / optical isomer for…
A: Phenyotin is a synthetic compound and also called Diphenylhydantoin and it is a potent…
Q: 5. Regulation of bacterial operons by inducers, e.g. lactose, exhibits which of the following…
A: The regulation of gene expression can occur at the level of transcription and translation.
Q: 2. Complete and identify the enzymes involved in the following pathways OydroyacetoreP tructose…
A: The glycolytic pathway helps to metabolize glucose molecules obtained through the diet, glycogen…
Q: 6. When a concentrated alkali solution acts on the purine cycle, it breaks down: A. Ester group B.…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: 1. A nucleoside is composed of Sugar and Nucleic Acid-Base. 2. The Nucleic Acid base in DNA and RNA…
A: Statement 1 is FALSE. BECAUSE NUCLEOSIDE IS COMPOSED OF NIYROGEN BASE+ PENTOSE SUGAR, NOT THE…
Q: 5. Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: What type of tertiary interactions do we observe for the two amino acid residues in the box? Draw…
A: It is the interaction between the R groups in the protein that determines tertiary structure. These…
Q: What are the major functions of lipids?
A: Lipids are essential fats that play significant roles in the human body. It's a prevalent…
Q: BACKGROUND A 2-year-old black girl is being seen by the hematologist after her pediatrician found…
A: Due to the lack of mitochondria, there is no TCA cycle occurring in the RBCs. So, RBCs obtain the…
Q: mixture of Alanine (pl 6.02), Glutamic Acid (pl 3.22), Glycine (pl 5.79), Lysine (pl 9.74) and…
A: As anion resin is positively charged, it attracts amino acids that have a negative charge. Proteins…
Q: Amino acids with non-polar side chains are zwitterions at a. middle pH levels, between the pKa’s of…
A: Amino acids are compounds with an amino group, a carboxyl group, a hydrogen atom, and a variable…
Q: Which reaction in glycolysis produces ATP as a product? Group of answer choices hexokinase…
A: Glycolysis : Process in which the glucose gets broken to produce pyruvate, ATP, NADH and water.
Q: 4. Why is the type of cell (aerobic/ anaerobic) important to the purpose of this enzyme?
A: Enzymes are highly efficient biological catalysts that speed up metabolism or the chemical reactions…
Q: Why are unsaturated fats considered healthier?
A: Unsaturated fatty acids consist of a double bond between molecules of the fatty acid chains, whereas…
Q: Which statement is correct about expression of a gene regulated by Gal4? O Galactose increases gene…
A: In yeast the transcriptional activator GAL4 binds to the upstream activating sequence of the gal…
Q: As listed in the LIPID MAPS Structure database, a synonym for 18:2w-3 using the (n-x) nomenclature…
A: LIPID MAPS computationally-generated database of "bulk" lipids.
Q: O dihydroxyacetone-P DHAP ATP ADP ATP ADP glucose-6-P G-6-P fructose-6-P F-6-P glucose…
A: In the diagram glycolytic pathway, pentose phosphate pathway and Leubering- Rapport shunt is given…
Q: Given Sorbitol, Briefly explain its expected reaction (based on their structural formula) to the…
A: Molisch's test is the specific test for Carbohydrates which give purple colour ring on addition of…
Q: How many ATP molecules are produced when 6 molecules of glucose enter glycolysis?
A: Glycolysis is a catabolic pathway in which six Carbon Glucose is catabolised into two 2carbon…
- _____DNA polymerase III
- _____Primase
- _____Helicase
- _____Lagging Strand
- _____Leading Strand
- _____RNA Primer
- _____Single Strand Binding Protein
- _____5’
- _____3’
- _____DNA Ligase
- _____ Topoisomerase
- _____Template Strand
- _____Coding Strand
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Fill in the palindromic sequence of the given DNA strand containing six bases. 5' GACGTC 3' 3' _ _ _ _ _ 5'Refer to the image and answer the questions. 1. Which among the two strands will have a continuous replication? 2. Which is the lagging strand? 3. Along which strand will Okazaki fragments appear? 4. How are Okazaki fragments joined together? 5. Where should the 3’ end of the lagging strand be located? On the right or left side?In only one sentences please define these three words 1. Conservative model of dna replication 2. Dispersive model of dna replication 3. Semi conservative model of dna replication
- Write down the complement strand of DNA for the following sequence and place the 3' and 5' on the appropriate ends. 3' - GGGCCTAATATAGCTTTACGGTAT - 5'Identify if the statement is correct or incorrect, "DNA ligase separates the two strands of the relaxed DNA helix, the point of separation is the replication fork."U UUU UAU 11yr Phe UUC UUA Leu UUG Jle UCU UCC UCA UCG UGU UGC Cys UGA Stop UAG Skop UGG Trp UAC Ser UAA Stop CUU CUC CỦA CUG CAU JHis CAC CGU CGC CGA CGG CCC Leu Pro Arg ССА Delete CCA CG CAA CAG JGIN Gln AUU AUC le AUA AUG Met AGU 1 Ser AGC AGA AGGJArg 1. ACU ACC The ACA ACG AAU M AAC AAA AAG Jlys JAun ATG AAC TAC CTA GGG ACA GAU JAsp GAC GAA GAG JGlu GUU GUC Val G GUA GCU GCC GCA Ala GCG GGU GGC Gly ATG ACC TAG GGA CA GGA GGG GUG G. Compare translation before and after the deletion. What effect might it have on gene function? Asp Daspartic acid lleI isolcucine Thr T threonine Leu L leucine Ser S serine Туr Y tyrosine Glu E glutamic acid Phe F phenylalanine Pro P proline His H histidine Lys K Arg R Gly G glycine lysine Ala A alanine arginine Cys C cysteine Trp W tryptophan Val V valine Gln Q glutamine Met M methionine Asn N asparagine Second Position UGU 1Cy UCU UCC Ser UCA UG UUU Phe UAU UAC Ty UAA Slop UGA Stop UAG Slop UGG Trp UGC UUC U UUA Leu ] low UUG CUU CÚC A Leu CCU CCC Pro…
- Describe and diagram the DNA damage done by UV radiation on a single strand of DNA. Describe in at least 1 sentence.(Select one answer from each dropdown menu:) DNA replication uses as templates to make an Choose one: GAUDIe copy of a DNA molecule. complementa DNA replication is known exact molecule has 1 original stChoose one: 1 new strand of DNA. This ensures the conservation of genetic information. because each new DNA (Select one answer from each dropdown menu: ) In mitosis, the goal is to get cells that are genetically Choose one: This process is used to make Choose one: Match the following Mitosis stages to what happens Prophase Metaphase Anaphase Telophase a. sister chromatids pull apart to opposite ends of cell b. chromosomes line up at the equator of the cell c. Nuclear envelope reforms and chromosome loosen d. nuclear envelope disappears, chromosoměs a. condense During what phase does the cytoplasm divide? (Select one answer from dropdown menu:) Choose one: (Select one answer from each dropdown menu and fill in the blank:) In meiosis, the goal is to get cells that are genetically Choose…You are studying a new virus with a DNA genome of 12 Kb. It can synthesize DNA at a rate of 400 nucleotides per second. If the virus uses rolling-circle replication, how long will it take to replicate its genome? Answer only for the first strand; ignore replication along the displaced strand. O 7.5 seconds O 15 seconds O 30 seconds O 1 minute O 2 minutes
- Complete the complementary strand: DNA replication ATTCGAGGCTAAShow the replication strands in each of these bubbles (note they have different DNA orientations). Label each end of each DNA strand and include arrows to show which direction it is extending. Show the Okazaki fragments in the correct places. 3' 5'The image shows a replication fork, template DNA strands, and new DNA strands. Label the image. and 13' 15' 3' 5' Answer Bank lagging strand leading strand replication fork template DNA strands