Match the items on the diagram with the correct term below. 3' 5' 5 D 8 Activate W DNA Replication Terms

The bacterial primase enzyme synthesizes _______________________.   a short DNA primer using RNA as a template a short protein primer using RNA as a template an RNA strand in absence of template DNA a short DNA primer using DNA as a template a short RNA primer using DNA as a template

The type of DNA replication error illustrated in the diagram below is _______________________.

Which enzyme catalyzes the elongation of a DNA strand in the 5' to 3' direction? Group of answer choices DNA ligase primase DNA polymerase I DNA polymerase III

Optimal DNA replication requires the coordinated effort of all the following EXCEPT:   gyrase   single strand binding proteins   DNA polymerase II   Primase

Which of the following is not necessary for replication to proceed? O MRNA O RNA primer O DNA polymerase O primase O DNA ligase

Which of the following enzymes is not involved in bacterial DNA replication?   DNA Polymerase III telomerase primase DNA polymerase I ligase

Telomerase contains both _______________ and _________________.   Question 14 options:   RNA and protein   DNA and protein   All of the above   RNA and DNA

The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during polymerase chain reaction (PCR) replication. Which of the following options best represents the primer?5’ – CGCGTATCGGGCTGTCGCGTCTTGCAGCTCG – 3’   a. 5’ – CGAUACGC – 3’   b. 5’ – CGATACGC – 3’   c. 5’ – CGAGCUGC – 3’   d. 5’ – CGAGCTGC – 3’   e. None of the above

Select the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer adds nucleotides to 3' end of DNA strand adds nucleotides to 5' end of DNA strand  does not require primer has 3'-to-5' exonuclease activity that allows "proofreading" of DNA strand being made