Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 10.L1, Problem 7WC
Summary Introduction
To determine:
If a complete cycle of PCR takes 3 minutes, how many strands of DNA would be present at the end of 10 minutes and 1 hour.
Introduction:
PCR duplicates DNA similar to bacterial binary fission. This is an exponential increase in the number of strands.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The way that PCR amplifi es DNA is similar to the doubling in a population of growing bacteria; a single DNA strand is used to synthesize 2 DNA strands, which become 4, then 8, then 16, etc. If a complete cycle takes 3 minutes, how many strands of DNA would theoretically be present after 10 minutes? After 1 hour?
To amplify a section of DNA using the polymerase chain reaction (PCR), all you need to load into the
tube is 1) a buffer solution, 2) the DNA you want to amplify, 3) some DNA nucleotides, 4) a
polymerase (like Taq polymerase), and
O an RNA polymerase
a set of forward and reverse primers
some phospholipids for a cell membrane
some ribosomes
Part 2. PCR
1) In one color, write out the forward primer (5’ GATAC 3’) in the correct position relative to the given template DNA sequence. In a second color, act as the polymerase and fill in the rest of the new strand of DNA
Primer/New Strand
Template DNA: 3’ TAGCTATGCGGACCTCATGCATTAGAGTAG 5’
Part 3. Restriction Enzymes
1) Consider the sequence of DNA given below and answer the following questions
5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’
3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’
a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest?
b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect?
2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and…
Chapter 10 Solutions
Foundations in Microbiology
Ch. 10.1 - Define genetic engineering, and describe some of...Ch. 10.1 - Explain the properties of DNA that lend to its...Ch. 10.1 - Summarize the major methods of analyzing DMA and...Ch. 10.1 - Describe the technology behind Identifying,...Ch. 10.1 - Define genetic engineering and biotechnology, and...Ch. 10.1 - Describe the processes involved in denaturing and...Ch. 10.1 - Define restriction endonuclease and explain what...Ch. 10.1 - Prob. 4CYPCh. 10.1 - Explain how electrophoresis works and the general...Ch. 10.1 - How would you make a copy of DNA from an mRNA...
Ch. 10.1 - Briefly summarize the steps involved in DNA...Ch. 10.1 - Outline the steps in the PCR technique and...Ch. 10.1 - What are the functions of primer and Taq...Ch. 10.2 - Explain what is involved in recombinant DNA...Ch. 10.2 - Characterize the events in cloning, using an...Ch. 10.2 - List and discuss some protein products of...Ch. 10.2 - What characteristics of plasmids and...Ch. 10.2 - Name several types of vectors, and list the types...Ch. 10.2 - Describe the basic principles behind recombinant...Ch. 10.2 - Summarize the characteristics of bacteria and...Ch. 10.2 - Outline the main steps in cloning a gene,...Ch. 10.2 - What is one way to determine whether a bacterial...Ch. 10.2 - Characterize several products that have resulted...Ch. 10.3 - Define what is meant by the term transgenic or...Ch. 10.3 - Describe the uses of genetically modified bacteria...Ch. 10.3 - Prob. 10ELOCh. 10.3 - Explain how DNA technology can be used to treat...Ch. 10.3 - Describe several uses of genetically modified...Ch. 10.3 - Prob. 18CYPCh. 10.3 - Why must animals usually be modified in the embryo...Ch. 10.3 - Prob. 20CYPCh. 10.3 - What are some ethical and biological...Ch. 10.3 - Outline the uses of gene therapy and gene editing...Ch. 10.4 - Outline the uses of gene therapy and gene editing...Ch. 10.4 - Describe two methods in performing a DNA analysis,...Ch. 10.4 - Describe several applications of DNA profiling and...Ch. 10.4 - Describe what a DNA profile is and how STRs and...Ch. 10.4 - Prob. 24CYPCh. 10.4 - Explain the origins of mtDNA and its importance in...Ch. 10.4 - Explain the difference between a DNA profile and a...Ch. 10.L1 - Which gene is incorporated into plasmids to detect...Ch. 10.L1 - Which of the following is not essential to carry...Ch. 10.L1 - Which of the following is not a part of the Sanger...Ch. 10.L1 - The function of ligase is to a. rejoin segments of...Ch. 10.L1 - The pathogen of plant roots that is used as a...Ch. 10.L1 - Prob. 6MCQCh. 10.L1 - Which DNA fragment will be closest to the top...Ch. 10.L1 - Prob. 8MCQCh. 10.L1 - For which of the following would not require a...Ch. 10.L1 - Prob. 10MCQCh. 10.L1 - What type of mutation caused Nicholas’s disease?...Ch. 10.L1 - Which type of cells were used to extract the DNA...Ch. 10.L1 - Lay out the genetics of Nicholas’s case,...Ch. 10.L1 - Prob. 1WCCh. 10.L1 - What is it about the endonucleases that prevents...Ch. 10.L1 - Prob. 3WCCh. 10.L1 - a. Explain what hybridization is and how it is...Ch. 10.L1 - Prob. 5WCCh. 10.L1 - Prob. 6WCCh. 10.L1 - Prob. 7WCCh. 10.L1 - Explain the kinds of study involved in genomics,...Ch. 10.L1 - For what reasons would gene therapy be more...Ch. 10.L1 - Prob. 10WCCh. 10.L2 - a. Give an example of a benefit of genetic...Ch. 10.L2 - a. When gene probes, DNA profiling, and sequencing...Ch. 10.L2 - Which suspect is the likely perpetrator according...Ch. 10.L2 - Trace the genetic steps in the development of a...Ch. 10.L2 - You are on a jury to decide whether a person...Ch. 10.L2 - Can you think of some reasons it would not be...Ch. 10.L2 - What would be some major impediments to...Ch. 10.L2 - Prob. 8CTCh. 10.L2 - Describe the main differences between genome...Ch. 10.L2 - Itemize all of the ways that microbes have...Ch. 10.L2 - Below are two unrelated DNA paternity tests: one...Ch. 10.L2 - Figure 9.25d, shown here, shows the original...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Some Steps Involved in Creating Recombinant DNA 1. Plasmid DNA is cut at the restriction site.2. Foreign DNA is cut at the restriction site.3. Plasmid DNA is opened and sticky ends are formed.4. Foreign DNA restriction fragments are isolated5. Target sequence in the plasmid is recognized by the restriction endonuclease.6. Target sequences in the foreign DNA are recognized by the restriction endonuclease.7. Foreign DNA restriction fragment is inserted into the plasmid at the restriction site.8. DNA ligase splices the foreign restriction fragment and the plasmid together. Identify the correct sequence of steps involved in cutting and reassembling DNA molecules to make recombinant DNA. Start with preparation of the plasmid DNA. Select one: a. 6, 2, 4, 7, 8, 5, 1, 3 b. 5, 1, 3, 6, 2, 4, 8, 7 c. 5, 1, 3, 6, 2, 4, 7, 8 d. 6, 2, 4, 5, 1, 3, 8, 7arrow_forwardFigure 17.7 You are working in a molecular biology lab and, unbeknownst to you, your lab partner left the foreign genomic DNA that you are planning to clone on the lab bench overnight instead of storing it in the freezer. As a result, it was degraded by nucleases, but still used in the experiment. The plasmid, on the other hand, is fine. What results would you expect from your molecular cloning experiment? There will be no colonies on the bacterial plate. There will be blue colonies only. There will be blue and white colonies. The will be white colonies only.arrow_forwardWhich of the following best describes the process of DNA sequencing? a. DNA is separated on a gel, and the different bands are labeled with fluorescent nucleotides and scanned with a laser. b. A laser is used to fluorescently label the nucleotides present within the DNA, the DNA is run on a gel, and then the DNA is broken into fragments. c. Nucleotides are scanned with a laser and incorporated into the DNA that has been separated on a gel, and then the DNA is amplified with PCR. d. Fragments of DNA are produced in a reaction that labels them with any of four different fluorescent dyes, and the fragments then are run on a gel and scanned with a laser. e. DNA is broken down into its constituent nucleotides, and the nucleotides are then run on a gel and purified with a laser.arrow_forward
- PCR is a very useful method in biotechnology because it does not require the 6 or more different key proteins/enzymes required for DNA replication in living cells. Explain how and why this technique only requires 1 enzyme to make lots of DNA.arrow_forwardThe tuble below shows part of the process of DNA replication Origin al ONA Strand Complementary DNA Strand A-C-C-G-T-A-C T-G-G-A A-T-G What is the most likely effect this could have on genetic information going forward? O There willl be no change in the genetic information that gets transmitted because the complementary strand will never be used as a template O There will not be a change in the genetic information that gets transmitted because the cells having the new section of DNA will cored any mutations O There will be a change in the genetic information that gets transmitted due to the complementary strand being used as a template in fulure DNA replication. OThere will be a change in the genetic information that gets transmitted because the sections of DNA with mistakes will be passed on to make future generalions songerarrow_forwardRecombinant DNA molecules are produced by incubating plasmids that have been broken open by a restriction enzyme together with DNA molecules containing complementary sticky ends in the presence of the enzyme ? 1) exonuclease 2) DNA connectase O 3) DNA ligase 4) DNA polymerase O 5) endonucleasearrow_forward
- Im designing a restriction cloning experiment. My professor said that plasmid and insert DNA work best in a 1:1 ratio. If my reaction does not work the first time I perform it, how would I ensure that the cause was the difference in concentration of reagents and how would I fix it so that the I have the correct concentration? If a restriction cloning experiment does not work, how could I be certain that it was due to an incorrect ratio of plasmid:insert and how can i fix this?arrow_forwardcompare and contrast DNA replication in the cell with PCR-based replication in the lab. Do these two processes use the same number of proteins, why or why not? What reagents are added to a PCR reaction and are the primers used in both made of the same material? What about the requirements of the replication fork, same or different?arrow_forwardThe temperature at which the primers and target DNA hybridize may be changed to influence the stringency of PCR amplification. What effect will changing the hybridization temperature have on the amplification? Let's say you have a certain yeast gene A and want to check whether it has a human equivalent. How might managing the hybridization's rigor benefit you?arrow_forward
- Describe the effects of the temperature change during polymerase chain reaction (PCR) What are the functions of the primer and Taq DNA polymerase during PCR? Explain how PCR is able to pick a single gene from a complex genome and amplify itarrow_forwardWhich of the following best describes the complete sequence of steps occurring during eve cycle of PCR? 1- The primers hybridize to the target DNA. 2-The mixture is heated to a high temperature to denature the double stranded target DNA 3- Fresh DNA polymerase is added. 4- DNA polymerase extends the primers to make a copy of the target DNA. E (2 Puan) 2, 3, 4 3, 4, 2 2, 1, 4 3, 4, 1, 2 1, 3, 2, 4arrow_forwardWhich ingredient will allow the DNA to form cloudy clumps which can be collected with tweezers salt rubbing alcohols detergent solution water What is the purpose of PCR? To copy and then make many copies of a specific region of DNA To copy the entire human genome To make just a few copies of DNA To reveal the sequence of a piece of DNA If enzyme catalase has an optimum pH of 7.0, What do you think will happen en the pH is lowered to 3.0? The rate of its enzyme action is increased. Its enzyme action is not affected at all. The rate of its enzyme action is decreased. Its enzyme action ceases or stops.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License