Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 10.1, Problem 6CYP
How would you make a copy of DNA from an mRNA transcript, what is this molecule called, and how would it be used?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
How would you make a copy of DNA from an mRNA transcript,what is this molecule called, and how would it be used?
How would you make a copy of DNA from an mRNA transcript and what is this molecule called?
What is the genetic code and what is it used for?
Chapter 10 Solutions
Foundations in Microbiology
Ch. 10.1 - Define genetic engineering, and describe some of...Ch. 10.1 - Explain the properties of DNA that lend to its...Ch. 10.1 - Summarize the major methods of analyzing DMA and...Ch. 10.1 - Describe the technology behind Identifying,...Ch. 10.1 - Define genetic engineering and biotechnology, and...Ch. 10.1 - Describe the processes involved in denaturing and...Ch. 10.1 - Define restriction endonuclease and explain what...Ch. 10.1 - Prob. 4CYPCh. 10.1 - Explain how electrophoresis works and the general...Ch. 10.1 - How would you make a copy of DNA from an mRNA...
Ch. 10.1 - Briefly summarize the steps involved in DNA...Ch. 10.1 - Outline the steps in the PCR technique and...Ch. 10.1 - What are the functions of primer and Taq...Ch. 10.2 - Explain what is involved in recombinant DNA...Ch. 10.2 - Characterize the events in cloning, using an...Ch. 10.2 - List and discuss some protein products of...Ch. 10.2 - What characteristics of plasmids and...Ch. 10.2 - Name several types of vectors, and list the types...Ch. 10.2 - Describe the basic principles behind recombinant...Ch. 10.2 - Summarize the characteristics of bacteria and...Ch. 10.2 - Outline the main steps in cloning a gene,...Ch. 10.2 - What is one way to determine whether a bacterial...Ch. 10.2 - Characterize several products that have resulted...Ch. 10.3 - Define what is meant by the term transgenic or...Ch. 10.3 - Describe the uses of genetically modified bacteria...Ch. 10.3 - Prob. 10ELOCh. 10.3 - Explain how DNA technology can be used to treat...Ch. 10.3 - Describe several uses of genetically modified...Ch. 10.3 - Prob. 18CYPCh. 10.3 - Why must animals usually be modified in the embryo...Ch. 10.3 - Prob. 20CYPCh. 10.3 - What are some ethical and biological...Ch. 10.3 - Outline the uses of gene therapy and gene editing...Ch. 10.4 - Outline the uses of gene therapy and gene editing...Ch. 10.4 - Describe two methods in performing a DNA analysis,...Ch. 10.4 - Describe several applications of DNA profiling and...Ch. 10.4 - Describe what a DNA profile is and how STRs and...Ch. 10.4 - Prob. 24CYPCh. 10.4 - Explain the origins of mtDNA and its importance in...Ch. 10.4 - Explain the difference between a DNA profile and a...Ch. 10.L1 - Which gene is incorporated into plasmids to detect...Ch. 10.L1 - Which of the following is not essential to carry...Ch. 10.L1 - Which of the following is not a part of the Sanger...Ch. 10.L1 - The function of ligase is to a. rejoin segments of...Ch. 10.L1 - The pathogen of plant roots that is used as a...Ch. 10.L1 - Prob. 6MCQCh. 10.L1 - Which DNA fragment will be closest to the top...Ch. 10.L1 - Prob. 8MCQCh. 10.L1 - For which of the following would not require a...Ch. 10.L1 - Prob. 10MCQCh. 10.L1 - What type of mutation caused Nicholas’s disease?...Ch. 10.L1 - Which type of cells were used to extract the DNA...Ch. 10.L1 - Lay out the genetics of Nicholas’s case,...Ch. 10.L1 - Prob. 1WCCh. 10.L1 - What is it about the endonucleases that prevents...Ch. 10.L1 - Prob. 3WCCh. 10.L1 - a. Explain what hybridization is and how it is...Ch. 10.L1 - Prob. 5WCCh. 10.L1 - Prob. 6WCCh. 10.L1 - Prob. 7WCCh. 10.L1 - Explain the kinds of study involved in genomics,...Ch. 10.L1 - For what reasons would gene therapy be more...Ch. 10.L1 - Prob. 10WCCh. 10.L2 - a. Give an example of a benefit of genetic...Ch. 10.L2 - a. When gene probes, DNA profiling, and sequencing...Ch. 10.L2 - Which suspect is the likely perpetrator according...Ch. 10.L2 - Trace the genetic steps in the development of a...Ch. 10.L2 - You are on a jury to decide whether a person...Ch. 10.L2 - Can you think of some reasons it would not be...Ch. 10.L2 - What would be some major impediments to...Ch. 10.L2 - Prob. 8CTCh. 10.L2 - Describe the main differences between genome...Ch. 10.L2 - Itemize all of the ways that microbes have...Ch. 10.L2 - Below are two unrelated DNA paternity tests: one...Ch. 10.L2 - Figure 9.25d, shown here, shows the original...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is the mRNA sequence of this DNA and in which direction will mRNA polymerase travel?arrow_forwardWhat is the name of the enzyme is responsible for transcribing the DNA sequence into mRNA? In your own words, explain what this enzyme does.arrow_forwardYou’re working in Marshall Nirenberg’s lab, trying to decipher the genetic code. You use several different synthetic repeating mRNAs in translation reactions and analyze the sequences of the polypeptides produced from each reaction. The results are summarized below. mRNA sequence used: ...CACACACACACACAC... Polypeptide produced: ...His-Thr-His-Thr-His-Thr ...mRNA sequence used: ...CCACCACCACCACCA...Polypeptide produced: ...Thr-Thr-Thr... and ...Pro-Pro-Pro... and ...His-His-His...mRNA sequence used: ...ACAACAACAACAACA...Polypeptide produced: ...Thr-Thr-Thr... and ...Asn-Asn-Asn... and ...Gln-Gln-Gln... Based on these results, write what amino acid each codon below corresponds to. If there is not enough information to narrow down to one amino acid, write all the possibilities.CAC: ___________________________ ACC: ___________________________ ACA: ___________________________ CAA: ___________________________ CCA: ___________________________ AAC: ___________________________arrow_forward
- Refer to the double stranded DNA molecule with the sequence below to answer the following questions: 5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’ 3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’ Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. DNA strand: mRNA: amino acid sequence:arrow_forwardYou’re going for a bike ride, and as your muscles work harder, your body needs to produce more of the enzyme. You now know genes are transcribed from DNA into RNA in the nucleus and translated from RNA into proteins by ribosomes. Explain the steps of its creation from DNA to protein. Aside for having a nasty inhibitor around like the one from that insecticide, how else might an enzyme end up being non-functioning? During transcription, a base substitution occurred. Explain two reasons why this change in nucleotide sequence could result in no change to the protein.arrow_forwardWhat is RNA transcript?arrow_forward
- Consider the following segment of a template strand of DNA: Part A -ATA AGC TTC GAC- What is the mRNA produced for the segment? -UAU-UCG-AAG-CUC- Part B Complete previous part(s) • Part C What is the mRNA if a mutation changes AGC to AAC? Part D Complete previous part(s) Part E What is the MRNA produced if G is inserted at the beginning of the DNA segment?arrow_forwardComplete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acidarrow_forwardHydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA? Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls. What happens to protein synthesis if a nonsense codon is inserted into the gene? Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations) Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.arrow_forward
- A segment of template DNA is known to contain the following base sequence: 3' GATACCTTTGTGTAGTCATCTT 5' a) Write the mRNA that would be transcribed from this DNA fragment. b) Highlight the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. asap pleasearrow_forwardGiven the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forwardGiven the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY