Electrophoresis data: Measure the distance (in millimeters) that each fragment traveled from thewell and record it in the tabie. Estimate its size, in base pairs, by comparing its position to theHindll lambda DNA markers. Remember: some lanes will have fewer than 6 fragments.H = HindllLargestfragmentfirstP PstlE = EcoRIL = lambdaDNA- norestriction digest restriction digest restriction digestof lambda DNAM = DNA markerof lambda DNAenzymeof lambda DNAEstmatedbase pairsDistancein mmEstimatedbase pairsDistancein mmEstimatedbase pa rsDistanceinmmEstimatedbase pairsDislanceDistancein mmActualbase pairs5 mm58 mm54nm26.5m 23.13049mBand 169 mm32.96 MmBand 29.41639 hm120mm87 mMBand 36.55741 mm127m1.00mmBand 44.3611.08mBand 52,3221482m65mm2,027Band 6Step 3. Now using the standard curve you created in the pre-lab exercises and the distances you measured above,predict the sizes of each fragment based on the distances traveled by comparison to your standard curve.

Introduction Gel electrophoresis is a laboratory technique for separating DNA, RNA, and protein…

Electrophoresis data: Measure the distance (in millimeters) that each fragment traveled from the well and record it in the table. Estimate its size, in base pairs, by comparing its position to the Hindll lambda DNA markers. Remember: some lanes will have fewer than 6 fragments. Largest fragment first P = Pstl L = lambda DNA- no enzyme M = DNA marker H = Hindll E = EcoRI restriction digest restriction digest restriction digest of lambda DNA of lambda DNA of lambda DNA Actual base pairs Distance in m Eslirated base pairs Distance Estmated base pairs Distance in mm Estimaled base pairs Distance Estimated base pa rs Distance in mm in mm 26.5m 23.130 49m 5% m円 Band 1 54 nm 32 96 MM 69 Band 2 9.416 39 hn 120m Band 3 6.557 41 nm CO 65 nm 1,00 94 1.08m Band 4 4,361 Band 5 2,322 Band 6 2,027 Step 3. Now using the standard curve you created in the pre-lab exercises and the distances you measured above, predict the sizes of each fragment based on the distances traveled by comparison to your standard curve.

Electrophoresis data: Measure the distance (in millimeters) that each fragment traveled from the well and record it in the table. Estimate its size, in base pairs, by comparing its position to the Hindll lambda DNA markers. Remember: some lanes will have fewer than 6 fragments. Largest fragment first P = Pstl L = lambda DNA- no enzyme M = DNA marker H = Hindll E = EcoRI restriction digest restriction digest restriction digest of lambda DNA of lambda DNA of lambda DNA Actual base pairs Distance in m Eslirated base pairs Distance Estmated base pairs Distance in mm Estimaled base pairs Distance Estimated base pa rs Distance in mm in mm 26.5m 23.130 49m 5% m円 Band 1 54 nm 32 96 MM 69 Band 2 9.416 39 hn 120m Band 3 6.557 41 nm CO 65 nm 1,00 94 1.08m Band 4 4,361 Band 5 2,322 Band 6 2,027 Step 3. Now using the standard curve you created in the pre-lab exercises and the distances you measured above, predict the sizes of each fragment based on the distances traveled by comparison to your standard curve.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter14: Biotechnology And Society

Section: Chapter Questions

Problem 9QP

See similar textbooks

Similar questions

Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI
Part A Which of the following statements concerning restriction enzymes is true? Select all that apply. ►View Available Hint(s) ☐ Restriction enzymes specifically target and cut RNA in a sequence-specific manner. Restriction enzymes occur naturally in viruses as a defense mechanism against bacteria. Some restriction enzymes generate overhangs in the target DNA sequence upon incubation. During a cloning experiment, the vector and target DNA should be cut with different restriction enzymes to ensure that sticky ends are generated. Submit
U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. PscI & GsuI ______________________________________________________________ ScaI, PdmI & BsaXI ______________________________________________________________ ScaI, SspI & EheI ______________________________________________________________
A Moving to the next question prevents changes to this answer. Question 1 Which step is NOT included in the technique called Southern blotting? O a. visualization by autoradiography or fluorescence imaging Ob. exposure to a 32p-labeled DNA probe Oc amplification of the restriction fragment-probe duplex d. hybridization of the probe with a restriction fragment having a complementary sequence Oe transfer of the mixture of restriction fragments into a membrane composed of nitrocellulose &Moving to the next question prevents changes to this answer. MacBook Pro esc Q Search Secure Search %23 2 & LO % 4
B. Restriction Mapping. Single and double digestion of plasmid pMCS326 were performed using the restriction enzymes Alulll and EcoRV. DNA fragments are shown in an electrophoretogram below. Construct a restriction map of plasmid pMCS326 for enzymes Alulll and EcoRV. 20 kb 11 kb 8 kb 6 kb kb 3 Alulll + Alull EcoRV ECORV | || Restriction Map:
Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately. 5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’
Formation ofa recombinant DNA molecule. GAATTC GAATTC CITAAG CITAAG double-stranded DNA DAATTO DAATTO CTTAA OG CTAA AATT GI AATT CTTAA GAARIC CTTAAG The enzyme that cataly zes the joining of fragments to form recombin ant DNA is: DNA polymerase DNA ligase helicase re striction endonuclease
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Sample Gel Electrophoresis: A brother and sister's DNA are cut with the same restriction enzyme and then the resulting DNA fragments are run on a gel next to each other. DRAW THE BANDS on the gel where theywould appear: • Carissa's DNA was cut into 4 pieces: 2- The pieces were 20 base pairs long, 10bp long, 8 and 5. 4- • Christopher's DNA was cut into 5 pieces: 6- They were 25 bp long, 10, 8 and the last two pieces were 8- koth 2 be long. 10 You can make a scale to helo you > 12 14 13. What did you do about the 2 DNA fragments that were 16- 18- both 5 base pairs long? 20- 22 24- 26 14. How many DNA fragment sizes do these kids have in common? Both the kids have two fragments similar. 8bp & 10bp I O 00 O 00 Carissa Smith Christopher Smith
You are provided with coiled DNA and plasmid DNA that you subject to gel electrophoresis. Draw this gel. Remember to indicate the direction in which your DNA is moving and also show any reference samples. Also remember to show all components of your gel. Exact fragment sizes are not important.
ull rain LTE 11:53 © 1 0 A 10% Done #1 Mol Bio Restriction Analysi... Complete the following problems. Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecular biology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequences by analyzing the fragments generated upon restriction digest, as in the example shown in Figure 1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjected the PMBBS plasmid to complete digestion by different combinations of three REs (EcoRI, BamHI, and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can glean from this gel, answer the questions that follow. EcoRI BamHI Xhol DNA size ladder 600 bp 500 bp 400 bp 300 bp 200 bp 100 bp VC 100bp Plus DNA ladder from Vivantis Technologies *The same total amount of DNA was loaded in each lane. 1. What is the total size of the PMBBS plasmid in bp? Answer: bp 2. How many cut sites on the…
DNA Profiles as Tools for Identification A PCR-based paternity test is conducted using STRs that consistently produce a unique DNA fragment pattern from a single chromosome. Examining the results of the following Southern blot, which male(s) can be excluded as the father of the child? Which male(s) could be the father of the child?