Answered: Which of the following mRNA codons…

Name: . Which of the following mRNA codons signals the start of translation
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: . Which of the following mRNA codons signals the start of translation in eukaryotic cells?5’-UGA-3’3’-AUG-5’5’-UAG-3’3’-GUA-5’5’-UAA-3’

Science

Biology

Which of the following mRNA codons signals the start of translation in eukaryotic cells? 5’-UGA-3’ 3’-AUG-5’ 5’-UAG-3’ 3’-GUA-5’ 5’-UAA-3’

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 3TYK

See similar textbooks

Similar questions

Figure 15.16 Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks the A site on the bacterial ribosome, and chloramphenicol blocks peptidyl transfer. What specific effect would you expect each of these antibiotics to have on protein synthesis? Tetracycline would directly affect: tRNA binding to the ribosome ribosome assembly growth of the protein chain Chloramphenicol would directly affect tRNA binding to the ribosome ribosome assembly growth of the protein chain
Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
Table 8.2: Transcription and translation of the first 7 codons in the B-globin chain of hemoglobin. Normal Sequence Mutated Sequence DNA DNA amino acid DNA DNA amino Codon MRNA Codon MRNA coding template strand coding template strand strand acid code code strand sequence sequence G 1 1 G G C 2 A 2 A 3 G G A A 4 4 C G A G G G G 7 A 7 A G G Shape of RBC Shape of RBC 23 3.
Which mRNA strand is complementary to this template DNA strand: 5’-CTGCAT-3’? 3’-AUGCAG-5’ 5’-CAUCUG-3’ 3’-CUGCAU-5’ 5’-AUCGAC-3’ 3’-GACGUA-5’ Which tRNA strand is complementary to the first codon in the above mRNA strand? 3’-GAC-5’ 5’-AUG-3’ 3’-CAU-5’ 5’-CAU-3’ 3’-AUG-5’ Which of the following amino acids is coded for by the above tRNA molecule (in a typical eubacterial cell like E. coli)? methionine N-formylmethionine threonine phenylalanine tyrosine
Which three codons would code for a different amino acid sequence from that coded for by the mRNA base sequence AGU-UCA-CCA? O AGU-UCC-CCG O AGU-UCG-CCC O AGC-UCA-CCU O AGC-UCU-CCU
What is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3' sequence? a5'-ATCGGATTC-3' b5'-GAAUCCGAU-3' c5'-GAATCCGAT-3' d5'-UAGCCUAAG-3'
Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine? Group of answer choices 5’-UACCUAGCU-3’ 5’-GUGCAAUUU-3’ 5’-AUGGUAACA-3’ 5’-GGUCGCCAU-3’
A peptide has the sequence NH 2-phe-pro-lys-gly-phe-pro-COOH. Which of the following sequences in the coding strand of the DNA could code for this peptide? O S'ACT-TAC-CAT-AAA-CAT-TAC-UGA 5' TTT-CCC-AAA-GGG-TTT-CCC 3' UUU-CCC-AAA-GGG-UUU-CCC 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG 5' GGG-AAA-TTT-AAA-CCC-ACT-GGG
26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C- A- A- G- T- A- C- T- T- G- T- T- T- C- T- T- A- A- A 5' A LIGUULAUGAOLAAAGAAUUL Phe- MRNA: Amino Acids: met Phe- met Asme -LyS- G la- 27. Suppose the two guanosine (G) nucleotides in3 above were changed to two cytosine (C) nucleotides. What is the new amino acid chain? 28. Suppose the two guanosine (G) nucleotides in #3 were removed from the DNA strand. How would this mutation affect the amino acid chain? Write out the new amino acid chain.
What is the sequence of the MRNA codon that binds to the anticodon 3'-AAG-5'? 5'-AAG-3' 5'-TTC-3' 5'-UUC-3' 3'-UUC-5'
The sequence below is an mRNA strand that is in the cytoplasm ready to translated by a ribosome. If the gene that codes for this mRNA mutated so that the codon in the red box became CUG. What effect would it have when the mutated mRNA was translated? 5' UUU GCC GCU AUG UUU AGC UCU ACU ACU CUC AUG AGU CGC UAG CAU CGA UGA 3 a) There would be a protein with just 4 amino acids made Ob) The mutated mRNA could not be translated Oc) There would a protein with just 3 amino acids made d) There would be a protein with just 5 amino acids made
The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5' - AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3' 5'- ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG What is the sequence of the DNA template strand? TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC Incorrect -3' -3'