Which three codons would code for a different amino acid sequence from that coded for by the mRNA base sequence AGU-UCA-CCA? O AGU-UCC-CCG AGU-UCG-CCC O AGC-UCA-CCU AGC-UCU-CCU

Refer to the genetic code table and the mRNA sequence below to complete this question: U C U G A U G G G C U U U...  beginning with the start codon, which amino acids, in order, are coded for by this section of mRNA? A) Thr-Met- Gly B) Met-Gly-Phe C) Ser-Asp-Gly-Leu  .

The sequence below represents a strand of mRNA. Draw a box around the start codon. Then use the codon table provided, translate the mRNA and write the amino acids that are coded for. Remember that the start codon also codes for an amino acid. Stop at the stop codon. There is a stop codon. If you don't find a stop codon, you've missed something important. UAUG CAUG GUUA AUC

Here is an mRNA sequence (written 5' → 3’) CCAU G U U U U A C c C U A A GUA A GG U A A U AGGU A A C A 3 4 5 6. 7 8 9 10 11 12 13 14 15 16 | 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 Using the genetic code, translate the mRNA. start and stop codons, etc. Write the translation below: don't forget what you know about translation, frames,

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated? The genetic code has been provided for you below. Second letter U C A G UAU UACJ UAA Stop UGA Stop A UAG Stop UGG Trp UCU ) UUU) Phe UUC J UGU U UCC UGC, U UUA LE Ser UCA -Leu UUG, UCG CAU САС His CAA CAG Gln CUU CCU CGU CGC Arg CỤC ССС Leu -Pro CỦA ССА CGA CUG СCG CGG AAC FAS AAGLYS AUU ACU AAU AGU Asn Ser AUC ile AUA AUG Met| ACG AGC AGA Arg AGG J АСС - Thr АСА AAA GAU Asp GACJ Ala GAA GUU GCU GGU U GUC Val GUA GGC Gly GGA GCC GCA GAG Glu GGG GUG GCG First letter Third letter

Indicate the mRNA sequence, coding sense DNA sequence and template DNA sequence that produced the following polypeptide. The signal “!” means a stop codon:MYCATEATMYRING!

Indicate the amino acid sequence of the protein encoded by the following mRNA molecule.  Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’