The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5' AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3' 5'- ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG What is the sequence of the DNA template strand? TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC Incorrect -3' -3'

Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT

Which of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5'-3'. OA. AAGAUCGUCGAUCGGUCAUG OB. AAGATCGTCGATCGG TCATG OC. GTACTGGC TAGCTGC TAGAA OD. GUACUGGCUAGCUGCUAGAA

The following sequence is the coding strand of a piece of DNA. Type out the corresponding template strand of DNA and the MRNA that could be made from this piece of DNA if you assume that transcription begins at the first nucleotide listed. Next, use the attached genetic code table to translate the mRNA into a polypeptide that could be made from the message and list that sequence along with those of the DNA and MRNA. Coding strand 5'-TACCGTATGATTCTCTTGTATGGGTAACC-3' Second letter U UUU UUC UCU UAU UGU Phe Tyr Cys UCC UCA UAC UAA STOP UAG STOP UGG| Trp UGC Ser UUA UGA STOP A UUG Leu UCG CUU CCU CC CAU CGU CGC His CUC C CUA CAC САА Leu Pro Arg CCA CGA Gln CUG СCG CAG CGG AGU Ser AAU AAC ACU AUU lle AUC Asn ACC ACA AGC Thr AAA AGA AUA AUG Met Arg ACG AAG Lys AGG GAU GCU GCC GUU GGU Asp GAC GGC GGA GUC Val Ala Gly GCA GCG GAA GAG GUA Glu GUG GGG Third letter UCAG UCAG 5CAG UCAG First letter