
Biochemistry
9th Edition
ISBN: 9781319114671
Author: Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Question

Transcribed Image Text:The sequence of part of an mRNA transcript is
What is the sequence of the DNA coding strand?
5'-
5' - AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3'
5'-
ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG
What is the sequence of the DNA template strand?
TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC
Incorrect
-3'
-3'
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 2 steps

Knowledge Booster
Similar questions
- Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCTarrow_forwardWhich of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5'-3'. OA. AAGAUCGUCGAUCGGUCAUG OB. AAGATCGTCGATCGG TCATG OC. GTACTGGC TAGCTGC TAGAA OD. GUACUGGCUAGCUGCUAGAAarrow_forwardThe following sequence is the coding strand of a piece of DNA. Type out the corresponding template strand of DNA and the MRNA that could be made from this piece of DNA if you assume that transcription begins at the first nucleotide listed. Next, use the attached genetic code table to translate the mRNA into a polypeptide that could be made from the message and list that sequence along with those of the DNA and MRNA. Coding strand 5'-TACCGTATGATTCTCTTGTATGGGTAACC-3' Second letter U UUU UUC UCU UAU UGU Phe Tyr Cys UCC UCA UAC UAA STOP UAG STOP UGG| Trp UGC Ser UUA UGA STOP A UUG Leu UCG CUU CCU CC CAU CGU CGC His CUC C CUA CAC САА Leu Pro Arg CCA CGA Gln CUG СCG CAG CGG AGU Ser AAU AAC ACU AUU lle AUC Asn ACC ACA AGC Thr AAA AGA AUA AUG Met Arg ACG AAG Lys AGG GAU GCU GCC GUU GGU Asp GAC GGC GGA GUC Val Ala Gly GCA GCG GAA GAG GUA Glu GUG GGG Third letter UCAG UCAG 5CAG UCAG First letterarrow_forward
- Sequence 1 : TACGCTACGGTAATC Sequence 2: TACGCTACTATCGTAarrow_forwardComplete the box below: Convert the following template strand of DNA bases into its complementary mRNA molecule. Next translate the DNA into a polypeptide chain of amino acids using the Table above. CAATATGGAAGCCGACTCACCCTAATTarrow_forwardGive the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'arrow_forward
- For each mutant, state what change has occurred in the DNA, whether it was a substitution by transition or transversion, sense mutation, nonsense or reading frame change. It must present the codon sequence. Normal nucleotide sequence starting from the third codon: CCC-ACG-GUG-ACG-ACA-CGG-UGG Please show the codon and nucleotide sequence of the mutation.arrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.arrow_forwardAre these true or false answers correct? If so, what is the proper word to replace the underlined words, for the false.arrow_forward
- Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A frameshift mutationarrow_forwardUsing the table of genetic code, choose the CORRECT protein sequence that will be produced from the following sense strand of DNA: 5'-AUG UCU GAC UAG TTG GAT CCC - 3' Second position First position (5' end) Third position (3' end) Phe Ser Tyr Cys U Phe Ser Тут Cys Leu Ser Stop Stop A. Leu Ser Stop Trp Leu Pro His Arg Leu Pro His Arg Leu Pro Gln Arg Leu Pro Gln Arg Ile Thr Asn Ser U Ile Thr Asn Ser Ile Thr Lys Arg A Met Thr Lys Arg Val Ala Asp Gly U Val Ala Asp Gly C Val Ala Glu Gly A Val Ala Glu Gly O a. Lys-His-Ala-Gly-Asn-Leu-Val O b. Val-Val-Ser-Pro-Leu-Asp-Thrarrow_forwardWhy would it be impossible for DNA splicing to occur utilizing the same mechanism as eukaryotic MRNA splicing? Spliced DNA could not be transcribed or translated DNA does not have a 3'-OH group for the initial nucleophilic attack that forms the lariat O DNA does not encode introns O DNA does not have a 2'-OH group for the initial nucleophilic attack that forms the lariatarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON

Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman

Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY

Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning

Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning

Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON