Which molecules are required during Translation? Choose ALL that apply Select all that apply:mRNA tRNA rRNA DNA cytoplasm nucleus C. Transcription and TranslationCellNucleusTranseriptionTranslationCyfopiasmNuclearMembraneBeginringof proteinNearty completedproteinDNANewly formedmessenger RNA (MRNA]MRNABosesRibosomeDouble hellunwindiCodonNucleotideTHE ROLE OF THE RIBOSOME IN TRANSLATIONAmino ocid binds toA TAaineo cfAminoacidNewly formedprofein cholnArgrinaIRNACA CCMRNANA BindsNucleusCodonCytopiasmCompietedprotein220

In biology & genetics, translation is defined as the interaction wherein ribosomes in the…

Answered: Which molecules are required during…

Which molecules are required during Translation? Choose ALL that apply Select all that apply: mRNA tRNA rRNA DNA cytoplasm nucleus

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 13P

See similar textbooks

Related questions

Q: put in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2.…

A: The translation is the process by which cells make proteins. Here, the mRNA formed by transcription…

Q: chances two people heterozygous for achondroplasia could have a normal child? alternate forms of…

A: Achondroplasia is a genetic disorder having autosomal dominant pattern of inheritance.

Q: How many tRNA molecules can associate with a ribosome at any given time during translation

A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…

Q: What genetic material in a living cell which is single stranded involved in the coding of genes for…

A: The flow of information in cells takes place from transcription to translation. The translation is…

Q: Translation always begins by adding a methionine to the beginning of every

Q: After transcription, how is mRNA processed in eukaryotes? (Choose all that apply) 3' polyA tail is…

A: TRANSCRIPTION It is the formation of mRNA from DNA. The mRNA formed has to undergo various…

Q: Which of the following is not directly involved in translation?

A: Translation is the cycle where ribosomes present in the cytoplasm or endoplasmic reticulum blend…

Q: What stops the translation process? when a stop codon on the mRNA enters the A site when a stop…

A: There are three types of stop codons which are present in m RNA and when they are encountered the…

Q: What is the function of polyadenylation in eukaryotes? (Choose all that apply) It moves ribosomes…

A: Polyadenylation is the addition of a poly (A) tail to a messenger RNA. The poly (A) tail consists of…

Q: How does initiation of translation occur in prokaryotes? Include a discussion of the ribosomal…

A: Like transcription, the process of translation also involves three successive stages- initiation,…

Q: Consider this list (below) of steps involved in translation. These steps are out of order.…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum generate…

Q: Which type of chemical bond is responsible for RNA-DNA base pairing during reverse transcription?…

A: The DNA and RNA nucleic acids that is composed of nucleotides. The nucleoitides are made up of…

Q: All of the following participate in the process of translation except: ribosomes mRNA tRNA 35S…

A: Translation It is defined as the process of production of proteins from the mRNA transcript. In…

Q: What is the difference between transcription and translation? Transcription is the conversion from…

A: The genetic material is stored in the DNA of the nucleus of the cell.

Q: for an in vitro translation reaction. Which one would you leave out? Cell sap containing ribosomes O…

A: In vitro translation is a technique that in which a given mRNA is translated (outide the cell using…

Q: A difference between bacterial and eukaryotic translation is Multiple Choice translation can begin…

A: A difference between bacterial and eukaryotic translation is A. translation can begin on an mRNA…

Q: Which of the following best describes a sequence of events that happens during the elongation phase…

A: The translation is a process by which protein is synthesized using mRNA as a template. This process…

Q: Which of the mechanisms below is essential for the correct initiation of translation in prokaryotes?…

A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum synthesise…

Q: Which of the following is NOT found on a mature eukaryotic mRNA molecule? (Choose all that apply)…

Q: Which of the following is least likely following translation termination? The polypeptide is…

A: Introduction: Translation of termination is process in which the genetic code is within a…

Q: A. RNA polymerase binds to a gene’s promoter. B. RNA polymerase moves over the gene and unzips the…

A: transcription is the process in which m RNA is formed as directed by the template strand of DNA.

Q: t Differentiate eukaryotic translation from prokaryotic translation by completing the table below.…

A: The translation is the process by which amino acid chain (protein) is produced from mRNA within the…

Q: Which of the following are steps of transcription? Select all that apply. a.RNA polymerase…

A: The function of a gene can be studied through expression in a particular cell and its interactions…

Q: Which of the following are involved in translation? Choose all that apply tRNA DNA ribosome…

A: The correct answer is t RNA, Ribosome, Amino acid, mRNA, rRNA

Q: You perform a translation experiment with mRNA and all required molecules in two identical test…

A: It is the process in which a RNA is coded to form a protein. The mRNA formed from the corresponding…

Q: Which of the following is true of transcription and translation in prokaryotes and eukaryotes? A. In…

A: Transcription is the process of formation if m RNA from the DNA. Translation is the process of…

Q: After translation a protein needs to be folded correctly in order to function properly: C) What…

A: Proteins are long chains of amino acids. There are 4 types of proteins based on their structure:…

Q: Which of the following is the definition of a gene? RNA that delivers amino acids to a ribosome…

A: Introduction A nucleoside and a phosphate make up nucleotides, which are organic compounds. They are…

Q: You perform a translation experiment with MRNA and all required molecules in two identical test…

A: Puromycin is a tyrosyl-tRNA mimic that works by identifying and releasing elongating polypeptide…

Q: How many copies of a protein can be produced from a single mRNA transcript? Many because copies of…

A: Transcription is the process by which an mRNA is synthesized from DNA which then undergoes the…

Q: What are the specific steps of eukaryotic translation? Be sure in your discussion that you include…

A: In transcription, a cell “copies” DNA sequence to a complementary RNA molecule. Then, in…

Q: 3)Which of the following are involved in translation? Choose all that apply ribosome tRNA amino…

A: Answer- Involved in translation are :- ribosome tRNA mRNA rRNA amino acids

Q: Sometimes errors occur during transcription or translation. each amino acid is coded for by several…

A: This suggests that the genetic code is degenerate which means that each codon is specific for only…

Q: In which direction does the ribosome move along RNA?

A: Nucleic acids are macromolecules present in each and every cell of living beings. They are mainly…

Q: Researchers are studying the mechanism of the antibiotic chloramphenicol. They know that it prevents…

A: The protein is synthesized by the process of translation. It takes place in cytoplasm of cell.

Q: You are searching the sequence of a coding strand of DNA. What kinds of sequences would help you…

A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…

Q: intervening sequence?

A: introduction Intervening sequence : Part of a quality that is at first interpreted from the DNA…

Q: In the elongation stage of translation, which of the following options is correct? the polypeptide…

A: The Central Dogma of molecular biology refers to the flow of information from DNA to RNA to…

Q: Why does translation need to happen

A: The DNA (deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Which of the following is observed in prokaryotes but not in eukaryotes? O In prokaryotes, ribosomes…

A: Prokaryotic cells are cells that do not have a true nucleus or membrane-bound organelles. Organisms…

Q: Which of the following is/are true? 1. Oils are different from fats because they are plant derived…

A: Oils are different from fats because they are plant derived and mostly contain unsaturaded fatty…

Q: Which of the following RNAs are required for translation? (Choose all that apply) tRNA rRNA…

A: Adenine, guanine, cytosine, and uracil make up RNA, which is a polymer of nucleotides composed of a…

Q: In the initiation of translation, the process always lines up at the start codon. What is the start…

A: Translation refers to the process of polymerization of amino acids to form a polypeptide. The order…

Q: If an mRNA nucleotide is synthesized from DNA, how do you identify the: 5’end; 3’ UTR;…

A: The promoter sequence serves as a site for binding of RNA (ribonucleic acid) polymerase. It is…

Q: Which process occurs with tRNA at the ribosomes? translation transcription…

Q: Which of the following is true about transfer RNA during translation? -Transfer RNA has anticodons…

A: To synthesize protein molecules, a cell must first transfer information from DNA to mRNA through the…

Q: Which molecules are required during Translation? Choose ALL that apply

A: Central dogma consists of replication, transcription and translation. Replication is the formation…

Q: Which of the following statements is TRUE? Group of answer choices The human DNA is single-stranded…

A: DNA is called deoxyribonucleic acids. DNA serves as the genetic material for most organisms present…

Q: Which components will end up in the final, fully processed MRNA in a eukaryotic cell? Choose all…

A: Post-transcriptional modifications are chemical modifications of the primary RNA transcript to…

Q: Transcription and translation both involve an initiation, elongation, and termination phase.…

A: Answer (1) :- Fragments of DNA that are responsible for different traits are known as genes. The…

Concept explainers

Structure and Composition of Cell Membrane

Despite differences in structure and function, all living cells in multicellular organisms are surrounded by a cell membrane. Just like the outer layer of the skin separates the body from its environment similarly, the cell membrane, also known as 'plasma membrane,' separates the inner content from its exterior environment.

Cell Membrane

The cell membrane is known by different names like plasma membrane or cytoplasmic membrane, or biological membrane. The term "cell membrane" was first introduced by C. Nageli and C. Cramer in the year 1855. Later on, in 1931, the term "plasmalemma" for cell membrane was given by J. Plowe. The cell membrane separates the cell's internal environment from the extracellular space. This separation allows the protection of cells from their environment.

Prokaryotes vs Eukaryotes

The cell is defined as the basic structural and functional unit of life. The cell membrane bounds it. It is capable of independent existence.

Question

100%

Which molecules are required during Translation? Choose ALL that apply

Select all that apply:

mRNA
tRNA
rRNA
DNA
cytoplasm
nucleus

C. Transcription and Translation
Cell
Nucleus
Transeription
Translation
Cyfopiasm
Nuclear
Membrane
Beginring
of protein
Nearty completed
protein
DNA
Newly formed
messenger RNA (MRNA]
MRNA
Boses
Ribosome
Double hell
unwindi
Codon
Nucleotide
THE ROLE OF THE RIBOSOME IN TRANSLATION
Amino ocid binds to
A T
Aaine
o cf
Amino
acid
Newly formed
profein choln
Argrina
IRNA
CA CC
MRNA
NA Binds
Nucleus
Codon
Cytopiasm
Compieted
protein
220

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Answer:

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

ebitgeqyloq erl to noihoq ertt qu 9lem bluow iert ebios onime et enimalsb nworle llew as yes TOi noitemoini ebulonl elelgmst AMO 3. The following MRNA strand is being used to assemble a polypeptide strand by a ribosome: 5'-AUGCUUGCUCAUCGGGGUUUUAA-3' AHR (a) Write out the amino acids that will be assembled, in their correct order. (b) Provide an alternative MRNA sequence with four or more changes that would translate to the same amino acid sequence.
SA p PDF as trasc d PDF During the translation of an mRNA segment, different activated tRNAs (aatRNAs)-specified here by their anticodons written 3' to 5' bind through hydrogen bonds to mRNA in subscripts-successively codons in the following order: Teas fill PDF Cave UNOFFIC aatRNAGAA binds, then aatRNACAC, then aatRNAUUG, then aatRNAGUU, then aatRNAGUG, then aatRNAGAC What would the sequence of that mRNA segment be? O GAA CAC UUG GUU GUG GAC O CUU GUG AAC CAA CAC CUG O CTT GTG AAC CAA CAC CTG O Glu-His-Leu-Val-Val-Asp hu O Search PD maste omiss
Туре of mutation: Effect: Original Altered protein/ amino acid sequence sequence DNA nucleotide MRNA AUUCGAGUA AUUCGGGUA amino acid MRNA ACGGAACCG ACGGUACCG amino acid MRNA GCUAGAAGU GCUUGAAGU amino acid MRNA GGCGCUACAUCA GGCAGCUACAUC A amino acid MRNA GGCGCUACAUCA GGGCUACAUCA amino acid
The journey of a c f t r protein covering translation at ribosomes etc
TACTCACCCCGTATTACGTTT What’s the MRNA Protein Phenotype
Translating mRNA C G A A U G C C G U A U U C G to amino acids
Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence into an amino acid sequence (protein). AUG AAA GGU CAC CCC TAG
Name: Clas: Date: Transcription 3" ATGACGGATCAGCCGCAAGOCGGAAfTGGCGACATAA UACUGCCUAGUCGGCGUU 3 5' WA WAW TACTGCCTAGTCGGCG TCGCCTTAACCGCTGTATT 3' 6 Label the diagram as you read the following passage. Transcription is the process cells use to copy information from DNA into messenger RNA copies. Part of the chromosome's tightly wound-up long strand of DNA is "loosened" to allow for RNA polymerase room to copy part of the DNA. Think of this as opening a page out of a giant book with thousands of pages to make a copy of just that one page. One side of the DNA strand is the template strand (or anti-sense strand) and is used by an enzyme called RNA Polymerase to create the messenger RNA. RNA Polymerase is directed by a bunch of proteins called transcription factors to the spot it needs to start copying. RNA Polymerase reads the template strand from the 3' end to the 5' end and creates a messenger RNA strand that is complementary to the template strand. In the diagram above, you can see that…
GENE E DNA TTTAA A MRNA Amino Acid
codon: 1 2 3 4 5 6 7 sequence: TAC ATG GAC AAT GAT TAG GGG 1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located . What mutation(s) would eliminate peptide translation? Use the codon numbers to help describe where the mutation is located
Complete the complementary strand: mRNA transcription ATTCGAGGCTAA
Ese biochemistry me Krna post