What is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3' sequence? a5'-ATCGGATTC-3' b5'-GAAUCCGAU-3' c5'-GAATCCGAT-3' d5'-UAGCCUAAG-3'

Q: Suppose the coding (sense) strand of some DNA has this base sequence: 5-GATGTATA-3' Write the base…

A: Nucleic acids are the biomolecules that essential for the existence of life. They are the genetic…

Q: Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA:…

A: INTRODUCTION The DNA and it's corresponding mRNA is given below.

Q: 5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ What does the newly formed RNA sequence look like if the RNA…

A: DNA forms a double-helix in which two antiparallel strands are wound around each other. The two…

Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…

A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…

Q: in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…

A: Transcription is the process that involves the synthesis of an RNA molecule from DNA. It is the…

Q: A segment of a protein-encoding gene sequence is given below. 5’-AAGTTTGGCACT-3’…

A: Transcription is the process by which the genetic information encoded in DNA is copied into a…

Q: If the template DNA is 3' A GCTAC5' then the mRNA sequence is

A: Ans- As mentioned the DNA template 3’ – A G C T A C – 5’ The mRNA sequence will be – a)          5’…

Q: If the sequence of a gene is: 3'TACATACCAACTGAGGATCGC5' 5'ATGTATGGTTGACTCCTAGCG3' And the RNA…

A: DNA is a double stranded helical structure found generally in Eukaryotes and prokaryotes while in…

Q: A template DNA strand for transcription is 5' - GAG GTG AAA - 3' What is the resulting RNA sequence…

A: Step 1 Base pairing is formed in DNA (Deoxyribonucleic acid) double helix between purine of one…

Q: Examine the following sequence of DNA 3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG –…

A: The central dogma is a metabolic process where the  DNA acts as genetic material and transcripted…

Q: if the codon for Leucine is 5'-CUG-3'. what is the sequence of the corresponding anticodon on the…

A: A transfer RNA (tRNA) is a type of RNA molecule whose primary function is to match an mRNA codon…

Q: DNA TAC-TAA-AGG-GAA-GAC-GAG-ATC mRNA AA

A: DNA synthesis or DNA Replication-It is the process by which a cell duplicates its genome(DNA)…

Q: A CODING STRAND of DNA has the sequence 5' ATGCCG 3' what would the resultant mRNA transcript…

A: Coding strand is the strand which contain the sequence that are identical to the mRNA transcript…

Q: What would be the sequence that the RNA polymerase synthese from the follwing DNA sequence? 5'…

A: Transcription: The process of formation of RNA from the DNA by  action of DNA dependant RNA…

Q: The DNA molecule shown below is thought to contain the genetic code for part of an enzyme that…

A: DNA is replicated to form new copies of DNA molecules that further are transcribed into mRNA. An…

Q: In the DNA  sequence,the bottom strand is a template strand.if the base pair

A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…

Q: Which mRNA sequences would form a structure that is a cue for transcription termination of some…

A: The ending of termination and the process involved in it are called transcription termination. The…

Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…

Q: DNA strand with the sequence 3’ AACGTAACG 5’ is transcribed. What is the sequence of the mRNA

A: Messenger RNA (mRNA) is a single-stranded RNA molecule that is complementary to one of the DNA…

Q: The sequence below is DNA from an unknown cell. Use what you know about transcription to infer some…

A: in the process of transcription, RNA is form from a DNA . DNA strand act as a template for the…

Q: Noncoding Strand -> 5’ - G   C     C     A   G     G   T       C     A     G   G     T -   3’…

A: The terms used in the question represents the molecules involved in gene expression. A gene is a…

Q: None

A: The given DNA3' CACTACGGCGCTGCGTGACCGATCACAGTGCGT 5' 5' GTGATGCCGCGACGCACTGGCTAGTGTCACGCA 3'  In the…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid whereas…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Which is the DNA template given if the MRNA is 3- CGGAUGCCCGUAUAC -5 ? O 3- GCCTACGGGCATATG-5 O 5-…

A: The common rule of Base pairing in DNA is: A pairs with T by a double bond and G pairs with C by a…

Q: What is the base sequence of the mRNA synthesized from the following DNA template strand?…

A: In order for a gene to be converted into a functional protein, two processes must take place namely…

Q: How many different single-nucleotide substitutions* (changing one nucleotide to another) in the DNA…

A: The single nucleotide substitutions that can occur to result in a non-sense mutations are -  i) CAA…

Q: What type of mutation is shown in the diagram?   Why do you think this type of mutation is referred…

A: Mutations are alterations in the gene sequence due to presence or interference of certain mutagenic…

Q: The nontemplate strand of a gene reads 5' ATGCGCTAGCTG 3'. What is the sequence of the mRNA…

A: Template strand runs in the direction 3' 5' end and non template runs in the direction 5' 3'. mRNA…

Q: The following strand is a template strand: 3'-АТСТАСССТТCGACTAGAАСААСТ-5' The non-template strand is…

A: DNA ( Deoxyribonucleic acid) is ladder like helical structure which act as genetic material in most…

Q: Assume that you are a RNA polymerase. Which strand is the template strand?…

A: Second one is the template strand for RNA polymerase.

Q: What is the protein product of the following DNA sequence? 5'-AACTCCGACTACGCTCCATTTCGAGCA-3'…

A: Proteins are complex biomolecules made up of chains of amino acids that fold into specific…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: Deoxyribonucleic acid (DNA) is a double-stranded, a self-replicating material that is present in…

Q: What are the correct codons of the MRNA from the given DNA strand th needs to be transcribed? *…

A: Sense strand It is also called as the coding strand , plus strand or the non template strand. The…

Q: Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of…

A: Transcription is the process by which the information in a DNA strand (template) is copied into a…

Q: Suppose the coding (sense) strand of some DNA has this base sequence: 5'- ATATGTGG-3' Write the base…

A: In DNA Adenine, Guanine, Cytosine, and  Thymine are present as nitrogen bases. Adenine(A) binds with…

Q: Look at the MRNA strand below. There are at least a few bases before the "AUG" or the start codon.…

A: Several codons or triplet bases make up the universal genetic code. Over time, the standard code has…

Q: What is the mRNA sequence of this DNA and in which direction will mRNA polymerase travel?

A: Messenger RNA is also known as mRNA is a single-stranded RNA molecule, which is complementary to one…

Q: Name each of the processes pictured: 5'

A: protein synthesis ELONGATION PHASE OR PROCESS SPLICING TERMINATION PHASE OR PROCESS

Q: What is the sequence of bases in the template strand of DNA that codes for the mRNA in Problem?

A: The sequence of mRNA given in the problem is 5'AAA GUU GGC UAC CCC GGA AUG GUG GUC 3' and the…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.