Q: Direction: On the worksheet, all the DNA sequences run from 3' to 5'. Supply the corresponding amino…
A: 3' TAC TCC GGC TCT CCC AGT TGA ACT 5' The sequence given is 3' to 5' sequence. Let us transcribe it…
Q: 18)(recall) RNA polymerase moves along the template strand of DNA in the DIRECTION, and adds…
A: As per the guidelines we are supposed to answer only the first question, in case of multiple…
Q: ACAACCCCAAGCCTTC
A: Answer : PROBE - DNA probes are the short stretches of single stranded DNA used to detect the…
Q: A- What are the topological parameters (linking number, twist, and writhe) for a relaxed, 4,200 base…
A: Relaxed DNA has unwound loop not supercoiled and the two strands twist around the helical axis once…
Q: what are the purpose of sequence alignment? define local alignment and global alignment?
A: Alignments are an effective method for comparing similar DNA or protein sequences. DNA molecules are…
Q: When completing genome sequences, contiguous sequences, or contigs are important intermediates.…
A: * A contig refers to series of overlapping DNA sequences that are used to make physical map which…
Q: If pET32a(+) is digested simultaneously with SacI and Bc1I 1. How many fragments are created? 2.…
A: A restriction enzyme or restriction endonuclease is an enzyme that cleaves/cuts DNA into fragments…
Q: Consider the λ bacteriophage DNA molecule as shown in Figure 21.14. Total digestion with the two…
A: DNA or deoxyribonucleic acid is a type of biomolecule. It is a polymer of deoxyribonucleotides…
Q: Write advantage and drawbacks of RISA (Ribosomal Intergenic Spacer Analysis) technique. What is the…
A: RISA is the technique for microbial community analysis. It helps in determining the species…
Q: 14) (recall) A particular triplet of bases in the template strand of DNA is AGT. The corresponding…
A: During the method of transcription, the data encoded inside the deoxyribonucleic acid sequence of 1…
Q: What does BLAST stand for? Basic Local Alignment Search Tool Basic Local Alignment SequenceToo Best…
A: The best option is (a) Basic Local Alignment Search Tool.
Q: What are the limitations of BLAST (Basic Local Alignment Search Tool)?
A: Introduction Basic local alignment search tool is an algorithm and programme for comparing primary…
Q: DNA QUANTITATION Why is a reagent blank (containing no nucleic acids) is taken prior to measuring…
A: DNA QUANTITATION
Q: pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI:…
A: Given: Digestion of a plasmid PMDawn with EcoRI, BamHI, and EcoRI+BamHI are as follows: EcoRI: 20 kb…
Q: Design a pair of primers (22 nucleotides long each) for the following sequence to clone the full…
A: Primer is a short nucleic acid sequence that provides a starting point for DNA synthesis. It is used…
Q: cloned fragment of DNA was sequenced by using the dideoxy method. A part of the autoradiogram of the…
A: Introduction DNA sequencing is that the process of determining the sequence of nucleotides (As, Ts,…
Q: Lab 12- Gel Electrophoresis If provided an image or sample gel, can you use the MMR/DNA Ladder to…
A: Answer :: Gel electrophoresis is a method used to separate macromolecules like DNA, RNA, and…
Q: Horizontal sequence :VIRL Vertical sequence:MKF Scoring rules: g/o = -3, g/e = -1, match or…
A: In bioinformatics, the Substitution matrix is a method of finding the rate of similarity of a…
Q: what kinds of techniques are used to sequence large fragments of dna upto 50kb
A: With the advancement of science and technology in the field of life sciences, there has emerged…
Q: Horizontal sequence :VIRL Vertical sequence:MKF Scoring rules: g/o = -3, g/e = -1, match or…
A: A point accepted mutation (PAM) is the replacement of a single amino acid in the primary structure…
Q: Horizontal sequence :RIVL Vertical sequence:FMK Scoring rules: g/o = -3, g/e = -1, match or…
A: Substitution matrix are of two types called BLOSUM and PAM. Both these Substitution matrices are…
Q: Method on the following 5 sequences and find the best multiple sequence alignments. Sequence # 1:…
A: Progressive alignment is a heuristic for multiple sequence alignment that does not optimize any…
Q: How many base substitutions are there between these sequences? Count ONLY the instances where there…
A: Sequence alignment involves the comparison of sequences of a particular gene from various organisms…
Q: Describe sequence alignment. What kind of information do we obtain from pair wise or multiple…
A: Sequence alignment can be defined as the way in which sequences of DNA, RNA, or proteins are…
Q: Shine-Delgarno sequence polyribosome formation operator Two of the above are correct
A: Shine Dalgarno sequence present at the 5 ends of the mRNA preceding the start codon of mRNA. It…
Q: What is a T1-weighted sequence?
A: Magnetic Resonance Imaging (MRI) is a medical imaging technique based on the principle of NMR to…
Q: 3a)ClustalX software was used to perform multiple sequence alignment of the following five Nco…
A: Some frequently performed analysis via bioinformatics are DNA sequence analysis, amino acid…
Q: ZFNs What is it? And how it works in genome editing?
A: Zinc-finger nucleases are counterfeit limitation catalysts (artificial restriction enzyme) produced…
Q: Consulting Table 4.1, determine the length and the nature (59 or 39) of the overhang (if any)…
A: Restriction endonucleases are enzymes utilized in domain of genetic engineering for various…
Q: Select all that apply. The Klenow fragment: has primase activity. is an E. coli DNA polymerase…
A: DNA polymerase is an enzyme, which helps in the synthesis of the DNA complementary strand from the…
Q: Reset Help The protein appears to have regions that are closely associated with the region between…
A: TAL effectors are transcription factors secreted by bacterial pathogens. They are virulence factors…
Q: sequence accuracy low then what effect on diagnosis?
A: Sequence accuracy is mainly of two types read accuracies and consensus accuracy. Read accuracy is…
Q: 17. Complete the following Central Dogma Grid Puzzles: First determine which DNA strand is the…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: Compare sequencing method 1 Illumina and sequencing method PacBio for: a. Read length. What are the…
A: Illumina sequencing methods are also called short read methods as they read shorter sequences in a…
Q: Determine the exact molecular weight of the following oligonucleotide and calculate the average…
A: Oligonucleotides are short sequences of RNA or DNA, which are oligomers. These short sequences are…
Q: Ruwaifa want to compares a nucleotide query sequence what option he will opt in BLAST and why?
A: BLAST is Basic local alignment search tool used to compare the queries in a DNA database. They are…
Q: Describe the difference between Sanger based sequencing and Next Generation Sequencing (NGS). Why is…
A: Step 1 Sequencing is the establishment of the primary structure of an unbranched polymer. Sequencing…
Q: The optimal design of primers is critical to the effective amplification of DNA sequences. i)…
A: INTRODUCTION Polymerase chain reaction (PCR) is a method widely wont to rapidly make millions to…
Q: Horizontal sequence :VIRL Vertical sequence:MKF Scoring rules: g/o = -3, g/e = -1, match or…
A: Introduction Amino acids are the building blocks of proteins. The building blocks of life are amino…
Q: What can we most-accurately say about the polypeptide with the primary sequence KNEADING? a.It has…
A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines…
Q: 7. You are preparing a library to sequence two samples, one from a WS and one from a FS, via…
A: Introduction An aligned read is that sequence which has been aligned to a common reference genome.…
Q: DNA Repication Explanation (no ESSAY) Must include STEP BY STEP Leading strand with 5' and 3'…
A: The process of replicating a double-stranded DNA molecule into two similar DNA molecules is known as…
Q: During nucleic acid hybridization, the probe is labelled for DNA stability to increase…
A: As per our honor code, we are allowed to answer one question at a time. You have posted multiple…
Q: Protein sequences are usually more advantageous than DNA sequence in the comparative pairwise…
A: Pairwise analysis of sequences helps in finding out the similar regions in the given set of two…
Q: Draw the structure of a dideoxynucleotide that would be used for DNA sequencing, and explain why…
A: Frederick Sanger developed the chain termination method to determine the sequence of nucleotides in…
Q: Expand PCR? Describe the different Steps involved in this technique?
A: PCR is an important technique in molecular Biology using which genes can be amplified easily. It…
Q: 9. Sequencing In order to ensure a reliable result, arrange the following procedure with A being the…
A: Mentioned steps of the procedure are performed to analyze the number of shoots and roots of onion.…
Q: TALENs What is it? And how it works in genome editing? Including
A:
Sequence alignment
1- Define the global and local alignments
2- What are the differences between local alignment and global alignment?
Step by step
Solved in 3 steps
- alignment in genomic research, list types of alignments and corresponding errors associated with specific sequence assemblies. Are there methods of alignment error filtering?In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertionPlease help witht this homework question A- What are the topological parameters (linking number, twist, and writhe)for a relaxed, 4,200 base pair circular double-stranded DNA plasmid? LK=? Tw= ? Wr=? The CRISPR-Cas9 protein first forms a protein-RNA complex with a guide RNA, and then binds to DNA sequences that match a 20-base target sequence within the guide. When the CRISPR-Cas9 complex binds to DNA, it unwinds about 20 base pairs of the DNA double helix. B- Why is DNA unwinding required for CRISPR-Cas9 protein-RNA complexto recognize target sites? C-How would the topological parameters (linking number, twist, andwrithe) of the 4,200 bp plasmid in (A) change when the CRISPR-Cas9 complex binds the DNA and unwinds about 20 bp? Lk=? Tw=? Wr=? D- What is the linking number after the CRISPR-Cas9 complex cleaves theDNA?
- Need help 1) Say you have an organism with a genome of 1 thousand bases (103) and a forward primer made up of 5 nucleotides (aka, a 5-mer) a)How many possible 5-mers are there? Remember that each position in the 5-mer has one of four nucleotides. b) Pick a 5-nucleotide position at random in the genome: what’s the probability that your forward primer matches there? Focus for now just on one strand of DNA. c) Pick a random 5-nucleotide position in the genome: what’s the probability that your forward primer does NOT match there? Focus for now just on one strand of DNA. d) How many physical locations might your forward primer sit in the genome? Focus just on one strand of DNA. Ignore whether or not it matches at a given location. this is one question with different parts. I would really appreciate it if all parts are answered. and I will defiantly rate.What are the similarities and/or differences between interpreting Multiple Sequence Alignment (MSA) of conserved sequences at the DNA level versus the Amino Acid level? Please site references if possible and have 5+ sentences.Can you help with 1a please HELPFUL INFORMATION: When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. 1a. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?
- Instructions: Here is some information about the sequences: All these sequences, “SEQUENCE_21” to “SEQUENCE_27” are in the same subfamily or “clade” of a large phylogenetic alignment of all Rab proteins in these three species (see “Figure 1.pdf”,which is the second image, for a full view of gene family in humans, plants and yeast, see the “D” branch towards the bottom of the tree in Figure 1). “SEQUENCE_28” is a different Rab protein (actually it is the Rab39 protein at the bottom of the tree). “SEQUENCE_21” is from yeast. “SEQUENCE_22” to “SEQUENCE_25” are from the plant, Arabidopsis. “SEQUENCE_26” and “SEQUENCE_27” are from humans. Question: Based on the information above, what can you speculate about the possible evolution of the genes that “SEQUENCE_21” to “SEQUENCE_27” represent?Compute the percent identity of the following pairwise sequence alignment: -TGAGACTTAGAGT |..|... | | | | | ATAGGAGCGAGAGTSequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
- Calculate the dynamic programming matrix and the optimal local and global alignment for the DNA sequences a: GAATTC and b: GATTA, scoring +2 for a match, -1 for a mismatch, and using a linear gap penalty function WL) = -2L thank youbased on the pictures How many base substitutions are there between these sequences? Count ONLY the instances where there is ANY nucleotide difference between any of the sequences (leave out any indels in this count) Are there any indels in this alignment? (yes or no)8. Given the following two sequences, create a pairwise alignment by hand. Do not place any gaps in the sequences to optimize alignment. Use an identity matrix and BLOSUM62 substitution matrix to create the two sets of pairwise alignments. Report the identity, identity score, similarity, and similarity score.Sequence 1: ATPL MSequence 2: ATKI M