How many base substitutions are there between these sequences? Count ONLY the instances where there is ANY nucleotide difference between any of the sequences (leave out any indels in this count) Are there any indels in this alignment? (yes or no)

Align two sequences: horizontal – GGAATGG, vertical – ATG, m= 2, mm = 0, g/o = -2, g/e = -1. Complete the NW matrix below and show the alignment paths. Write down and score all optimal alignments. Part 2. Dynamic Programming Assignment, Needleman-Wunsch Algorithm, Affine Gap Cost Click the shapes and move them using arrow keys (or drag). Click the shapes and right-click to copy/paste or click and use Ctrl + C to copy, then Ctrl + V to paste (in MS Word). 0000 Align and score all optimal alignments here. 0000

How would I calculate sanger sequencing fragments that will produce green

Using the Dynamic Programming algorithm for pairwise local alignment we covered in class, construct the dynamic programming score table for a local alignment of the following two sequences, using the following scoring parameters: match score = +5, mismatch score = -3, gap penalty = -2.:   ACGTATCGCGTATA   GATGCTCTCGGAAAWhat is score of the best local alignment between these two sequences? Show the alignment of these sequences.    asap

5' 3' O Top strand 5' O Bottom strand Primer 1 ORF Primer 2 5' 3' You have designed primers to amplify an ORF (gray box). The primers are labeled in red (Primer 1 and Primer 2) with their 5' ends labeled in red. Each primer can anneal/hybridize to the sequence of one of the two DNA strands. To amplify the indicated ORF, which strand of DNA must Primer 1 anneal/hybridize to? 5'

THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes for first eight amino acids of the B chain of hemoglobin. The B chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA? 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 8. 7. What mRNA will be formed from the mutated template strand of DNA? What amino acids will this new mRNA from the mutated template strand code for? 9. Are these new amino acids the…

The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…

for this question please help find  pairwise differences and segregating sites

what is the minimum edit distance between the following pair of sequences? TTGACG         TTTAGT - 0 - 1 - 2 - 3

If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the complimentary strand without and spaces, commas, symbols or anything else besides the nucleotide sequence (e.g. only: AAGCATCCGCTTA). Give me the complimentary sequence in the 3' to 5' orientation.