When completing genome sequences, contiguous sequences, or contigs are important intermediates. Which of the following is true about contigs? Group of answer choices The smaller the contig, the better it is for a complete genome assembly. A contig represents the sequence production from a single sequencing reaction. A contig is the name for a fragment of DNA made from a larger genomic DNA or chromosome, prior to its sequencing. A contig represents a DNA sequence assembled from smaller sequencing reads, and has no gaps.

When completing genome sequences, contiguous sequences, or contigs are important intermediates. Which of the following is true about contigs? Group of answer choices The smaller the contig, the better it is for a complete genome assembly. A contig represents the sequence production from a single sequencing reaction. A contig is the name for a fragment of DNA made from a larger genomic DNA or chromosome, prior to its sequencing. A contig represents a DNA sequence assembled from smaller sequencing reads, and has no gaps.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Question:- When large genomes are sequenced, which of the following is true? Group of answer choices The genomes are converted from RNA to cDNA using reverse transcriptase, and then the cDNA is sequenced. The genomes are fragmented, the DNA fragments are sequenced by any number of methods, and the sequences assembled to provide the original complete genome. Sanger dideoxy sequencing is never used – instead, only nanopore sequencing is used. The assembled sequences must have all gaps closed if the genome is to be useful for the research community.
Question:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCG
Genetics Attached is a segment of DNA (doublestranded). Answer the following questions about the segment of DNA: How many open reading frames (ORF) are in this sequence? How many amino acids are encoded in all open reading frames in this segment/sequence? Which strand is the template strand for the longest open reading frame?
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
There are numerous methods for sequencing DNA, including classical Sanger sequencing, automated Sanger sequencing, and next-generation sequencing technologies, including Illumina technology. Match the modified cytidine nucleotide triphosphates (NTPs) with DNA sequencing methods that utilize them. Classical Sanger sequencing HO-P=O O HO-P=O O HO-P=O O Automated Sanger sequencing -NH₂ CH3 H₂CN ° ? ?N HOOOO OH OH OH NH CH₂ Next-generation DNA sequencing (Illumina) CH₂ NH₂ Answer Bank
What is the role of di-deoxy DNTPs in a Sanger sequencing reaction? Please select the answer that is most correct. The di-deoxy DNTPs are incorporated into the growing DNA molecule. The di-deoxy DNTPs terminate polymerisation of the growing DNA molecule, thereby creating fragments which all end in that specific di-deoxy base. Subsequent separation of the fragments by size facilitates the ascertainment of the sequence. The di-deoxy DNTPs facilitate polymerisation of the growing DNA molecule. this allows for multiple copies fo the template to be made for further analysis. The di-deoxy DNTPs terminate polymerisation of the growing DNA molecule. Ending the replication ensures that the molecules are not too long to be sequenced.
That's the result of Gel electrophoresis of genomic DNA ( Of genomic DNA extraction experiment), please discuss the results and label and name the image to illustrate the answer? - Marker band sizes in gel: From top (well side) to bottom the bands have the following size in base-pair/bp- 6751,3652,2827,1568,1118,825,630
Figure 9-22 shows the first steps in the process of making a DNA microarray, or DNA chip, using photolithography. Describe the remaining steps needed to obtain the desired sequences (a different fournucleotide sequence on each of the four spots) shown in the first panel of the figure. After each step, give the resulting nucleotide sequence attached at each spot.
How would you approach this problem? You plan to sequence the following DNA by Sanger sequencing. Your reaction includes your sequencing primer (5' is on the left) and template DNA (5' end is on the left), dNTPs, buffer, DNA polymerase and the following fluorescent ddNTPs: red ddGTP, green ddATP and blue ddTTP. Sequencing Primer: CCGCCGGGCCCCAT Template to be Sequenced: GAGCGGCGGGCTGAGTAGCTCGCCGCGGGGATGGGGCCCGGCGGATT
What size DNA fragment would be released after very mild digestion of chromatin with micrococcal nuclease? (This would represent a single cut per nucleosome.) 30 bp O 165 bp 146 bp 200 bp
Repeated sequences can be classified according to theirorganization in the genome as well as according to theirfunction. Give at least two examples of each.
The short DNA shown below is to be sequenced. Using your knowledge of how the Sanger method works, in the gel diagram, draw in the bands that will appear when DNA polymerase is added to the reaction along with the four different nucleotide mixtures indicated. Note that some of these mixtures are not what would normally be used in a sequencing reaction. Dideoxynucleatides (ddNTPs) are added in relatively small amounts. The asterisk represents a radioactive label. *5' - 3'-ОН 3' – -- ACGACGCAGGACATTAGAC-5' Nucleotide mixtures: A. DATP, DTTP, dCTP, DGTP, ddTTP (given) B. DATP, ATTP, dCTP, AGTP, ddATE C. dTTP, dGTP. ACTP, ddCTP, ddATP D. DATP, dCTP, dTTP, ddGTP A в с D | || ||