Select all that apply. The Klenow fragment: has primase activity. is an E. coli DNA polymerase fragment. has exonuclease activity. is RNA-dependent DNA polymerase. has polymerase activity.
Q: Compare and contrast the properties of the enzymes DNA polymerase I and polymerase III from E. coli.
A: Replication is a process, which involves the synthesis of DNA from the template DNA, with the help…
Q: Polymerase chain reaction is— a reaction involving a chain of different types of polymerases…
A: PCR is a technique to make many copies of DNA in vitro. It relies on thermostable Taq polymerase and…
Q: An investigator obtains a bacterial temperature-sensitive mutation that affects a step in the…
A: Every DNA molecule is twisted into a ladder form known as a "double helix." The backbone of the DNA…
Q: DNA synthesis has a very low error rate. One reason for this is that the DNA polymerase enzyme can…
A: DNA polymerase is the enzyme that does maximum of the work throughout DNA replication. It builds a…
Q: Prior to the action of DNA ligase, how many hydrogen bonds are holding these two DNA fragments…
A: Introduction DNA strand is composed of three components: Deoxyribose Sugar Nitrogenous Bases…
Q: The proofreading function of DNA polymerase involves the recognitionof a ________ and the removal of…
A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…
Q: TaqMan probes can specifically measure human DNA concentration, but SYBR Green I cannot-explain.
A: Biotechnology is technology that utilizes biological systems, living organisms or parts of this to…
Q: ) Base excision repair requires polymerases. B.) In DNA repair by excision, the non-damaged strand…
A: Solution : Correct option is d
Q: DNA polymerases ___. catalyze carbon bonding seal gaps in the sugar-phosphate backbone add new…
A: DNA STRUCTURE:- DNA structure is given by Watson and Crick, who proposed the double-helical…
Q: Methods of IS DNA Sequencing
A: DNA sequencing is the process of getting the sequence of nucleotides in a DNA. Every DNA consists of…
Q: Using this strand of DNA (TACAACTGA), show what a deletion and insertion would look like”
A: Nucleotides are subunits of DNA, and each nucleotide is made of a sugar molecule called deoxyribose,…
Q: How would nucleotide excision repair be affected if one of the followingproteins was missing?…
A: The process of identification and correction of damaged DNA molecule by a cell which encodes its…
Q: List the steps in the polymerase chain reaction; discuss one disadvantage to this technique
A: Introduction Almost all the molecular biology techniques revolve around DNA/RNA/Proteins. DNA is one…
Q: Copying errors that slip by DNA polymerase proofreading can be corrected by DNA ligase. direct…
A: The major inheritable material is the Deoxyribonucleic Acid (DNA). The mechanism of copying…
Q: Which of the following statements regarding Nucleotide Excision Repair (NER) and Base Excision…
A: Base excision repair is the mechanism of repair of DNA which has been damaged and this repair occurs…
Q: Would you choose an exonuclease while producing a recombinant DNA molecule?
A: Exonuclease eliminates nucleotides from the ends of the DNA and thus it can't help in secluding…
Q: Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to…
A: Answer: REPLICATION of DNA : It is the process in molecular biology where DNA strands are used to…
Q: Consider prokaryotes, choose the CORRECT enzyme/keyword for the following function/role: Seals the…
A: DNA Ligase
Q: Describe the characteristics of the extracted DNA, such as colour, shape, size, and consistency.
A: Deoxyribonucleic acid (DNA) is a genetic information-encoded molecule. This information is used to…
Q: QUES Place the following enzymes in the correct order, in which they function in DNA replication:…
A: DNA replication is the process of copying genome's DNA. It occurs in three steps - Initiation…
Q: Your colleague made the table below comparing DNA Polymerase to RNA Polymerases. Which row is…
A: Transcription is the molecular process which involves the DNA sequences that are transcribed as…
Q: Similarities between DNA agarose gels and SDS-PAGE are:
A: Gel electrophoresis is the technique of separation of molecules of the basis of their size and…
Q: Recall that Meselson and Stahl used heavy nitrogen (N15) and light nitorgen (N14) to determine the…
A: Introduction: DNA, or DNA, could be a kind of genetic material that transmits information from one…
Q: Replication Practice: Label the parts of the diagram, write the correct letters in the boxes: DNA…
A: DNA replication is occurs in all living organisms.
Q: A person with deficient or abnormal ligase may have an increased cancer risk and chromosome breaks…
A: Enzymes are essential biocatalysts for all living cells. Enzymes carry out various functions in the…
Q: A. write one difference between DNA Replication in vivo and PCR. Draw two pictures which clearly…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: What enzyme proofreads the DNA molecule? Group of answer choices DNA gyrase DNA polymerase I DNA…
A: DNA replication is the process of synthesis of a new DNA molecule from a parent DNA by the enzyme…
Q: Discuss the benefits of being able to predict protein structure from the DNA sequence (proteomics).
A: Predicting protein structures from their DNA sequence is an important tool nowadays in computational…
Q: The proofreading function of DNA polymerase involves therecognition of a ________ and the removal of…
A: The process proof reading involves the removal of a newly added incorrect nucleotide. DNA polymerase…
Q: DNA Polymerase Another enzyme, and arguably the most important, is DNA polymerase. This enzyme's…
A: DNA Polymerase and DNA Primase are the Enzymes responsible for the DNA replication process.
Q: Illustrate the steps and other methods involved in recombinant DNA
A: Recombinant DNA technology is the latest and advanced technique in the molecular biology and…
Q: DNA mismatch repair enzymes preferentially repair bases on the newly synthesized DNA strand, using…
A: DNA mismatch repair enzymes play an important role in maintaining the accuracy of DNA replication.…
Q: Select the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer…
A: DNA is the genetic material of almost all the organisms, except few viruses and is present in the…
Q: Review DNA sequencing and cloning tools. Which of these is not used to make a recombinant DNA?…
A: DNA cloning is a process by which identical copies are made from perticular pieces of DNA.
Q: Which repair process(es) use(s) a DNA polymerase? Select all that apply. base excision repair…
A: DNA polymerases are the enzyme required for the synthesis and replication of DNA. There are…
Q: Elaborate on the multidisciplinary applications (at least 3) of Recombinant DNA Technology. Give…
A: The recombinant DNA (rDNA) is an innovation that utilizes enzymes to reorder together DNA sequence.…
Q: What would happen if DNA Polymerase II is mutated? Elaborate. Differentiate the Shine-Dalgarno…
A: DNA Polymerase II helps in the repair of damaged or mismatched nucleotide base pairs. If the DNA…
Q: Earlier, proofreading DNA polymerases used to have higher fidelity than that of Taq DNA pol. but…
A: PCR is polymerase chain reaction. It was used initially for polymerization of the small fragments of…
Q: Discuss the following statement: “primase is a sloppy enzyme that makes many mistakes. eventually,…
A: Enzymes are biocatalysts that aid in the speeding up of reactions. They are proteins that help to…
Q: design a analog of dna intercalator which has electrostatic interactions with DNA and crosslinks…
A: DNA intercalators are hydrophobic aromatic heterocyclic compounds with flat surfaces (polycyclic,…
Q: Single-strand binding proteins keep the two parental strands of DNA separated from each other until…
A: Deoxyribonucleic acid or DNA is the genetic material that is passed on from the parents to the…
Q: Explain the concept & importance of DNA polymerase III ?
A: The hereditary material of an organism is the gene. Genes are present in the DNA of an organism. The…
Q: Discuss the use of gel electrophoresis for the separation of macromolecules (DNA, RNA and protein)…
A: In biotechnology the gel electrophoresis is routinely used technique that is used for the separation…
Q: Give one more example of chemical (besides acids and alkalis) which can also affect DNA stability.…
A: DNA is important as it carries all the cell's information and the hereditary information. This makes…
Q: What is the meaning of proofreading activity ? O A. The polymerase checks for the correct…
A: DNA means deoxyribo nucleic acids. DNA act as genetic material in most organisms present on earth.…
Q: Find out whether the following are true or false. a)Klenow polymerase is E. coli DNA polymerase I…
A: Polymerase chain reaction involes denaturation, annealing and extension steps at varied temperature…
Q: Distinguish DNA-dependent DNA polymerases, DNA-dependent RNA polymerases, RNA-dependent RNA…
A: DNA-dependent DNA polymerases: These are responsible for the synthesis of new DNA from dNTPs…
Q: Which of the following has activity that is most similar to RNA Polymerase? Helicase DNA…
A: RNA polymerase It is defined as the enzyme which is involved in copying the sequences of DNA into…
Q: Choose reactions that always require hydrolysis of ATP. Select all that apply. sliding along…
A: Deoxyribonucleic acid (DNA) is a double stranded helical genetic material containing thousands of…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGACSelect the CORRECT pairing. DNA polymerase I : links Okazaki fragments together DNA helicase : unwinds both strands of DNA Primase : removes RNA primer DNA ligase : synthesizes DNA primerTranslesion synthesis (TLS) polymerase zeta (ζ) is capable of accurately reading through 6,4-photoproducts (cytotoxic damage). If this protein is non-functional: a different TLS polymerase will accurately read through the DNA lesion. a different TLS polymerase will inaccurately read through the DNA lesion resulting in increased mutational frequency. the replicative polymerase will inaccurately read through the DNA damage. DNA polymerase alpha (α) will be recruited to synthesize a primer across the DNA damage. the DNA lesion cannot be bypassed and will result in double stranded DNA breaks.
- Choose the right combination of components required to set up a polymerase chain reaction from the following: Template RNA, two primers, NTPs, and DNA polymerase Template DNA, two primers, dNTPs, and DNA ligase Template DNA, two primers, NTPs, and DNA ligase Template DNA, two primers, dNTPs, and DNA polymeraseOrder the steps required to sequence a region of DNA using dideoxy sequencing. Amplify the region of DNA to be sequenced add a primer, deoxynucleotides, labeled dideoxynucleotides, and DNA polymerase a primer binds to the single-stranded DNA template DNA polymerase extends the primer, incorporating deoxynucleotides a labeled dideoxynucleotide terminates the growing DNA chain gel electrophoresis separates the mixture of DNA fragments by size The DNA sequence is determined denature the double-stranded DNA Answer BankSelect the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer adds nucleotides to 3' end of DNA strand adds nucleotides to 5' end of DNA strand does not require primer has 3'-to-5' exonuclease activity that allows "proofreading" of DNA strand being made
- Polymerase chain reaction is— a reaction involving a chain of different types of polymerases acting successively on a DNA. a way DNA replicates in the living cell. governed by the Henderson-Hasselbalch equation. a chain reaction mediated by polymerase to amplify DNA fragments of defined sequence. DNA polymerization without a template.Fill in the blank spaces below with the most appropriate terms. The word bank is not provided. DNA replication in bacterium Escherichia coli begins at a site in the DNA called At the replication fork, the strand is synthesized continuously while the strand is synthesized discontinuously (in fragments). The new DNA strand, which is synthesized discontinuously, initially consists of short DNA pieces that are called A short RNA primer at the beginning of each of the DNA fragments is synthesized by an enzyme called and this RNA primer is later removed by the enzyme called using its activity. Single-strand breaks (nicks) that are left behind in this process are sealed by the enzyme called A Moving to another question w!l save this resporse Quebon 4 InChoose reactions that always require hydrolysis of ATP. Select all that apply. sliding along template strands unwinding of DNA strands by helicase formation of the phosphodiester linkage by DNA ligase unwinding of DNA strands by B2 subunits formation of the phosphodiester linkage by DNA polymerase I
- The image below shows the replication bubble of a piece of DNA in the process of replication. However, the image only shows the DNA strands being replicated. Fill in the rest of the elements of the figure, specifically: primers, Okazaki fragments, newly replicated leading strand DNA, as well as the enzymes helicases, primase, DNA polymerase III, DNA polymerase I, and ligase. Also, be sure to indicate the 5' and 3' ends of all nucleic acid polymers.Rank from the first to the last steps in DNA synthesis. Reset H DNA polymerase DNA strands separate as the enzyme helicase unwinds them DNA polymerase catalyzes the covalent addition of free nuclectides to the growing new DNA strands The enzyme primase builds ANA primers on the existing DNA strands Two identical doutle helices First LastCompare and contrast the properties of DNA polymerase and RNA polymerase. Drag the appropriate items to their respective bins. can proofread using a 3'-to-5' exonuclease activity polymerize in a 5'-to-3' direction Only RNA can initiate strand synthesis catalyze phosphodiester bond formation to polymerize nucleotides into nucleic acids Only DNA use deoxyribonucleotide triphosphates as substrates can only extend an existing strand Both Reset Help dependent on a DNA sequence template use ribonucleotide triphosphates as substrates