In the following gel showing stained bands of the Alu insertion sequence, what is the gem of individual 2? 941 bp->> 641 bp 1 2 3 456 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion
Q: What are the potential long-term ecological consequences of widespread fungal infections on plant…
A: Fungal diseases exploit various plant weaknesses, leaving plants prone to more disease and insect…
Q: Phenylketonuria (PKU) is an autosomal recessive disease that results from a defect in an enzyme that…
A: PKU or Phenylketonuria is a genetic disorder related to failed metabolism of an amino acid. The…
Q: chloroplasts
A: They are specialized organelles which are found in plant cells and some algae. They are not found in…
Q: In the RNAi response: Group of answer choices Dicer produces siRNA from the trigger molecule. These…
A: Gene regulation is greatly aided by RNA interference (RNAi), which is a vital biological function.…
Q: In the pedigree below what type of disease trait expression pattern is being observed? a…
A: Pedigree is a family chart showing the inheritance of a particular trait through several…
Q: MBS crosslinker contains aromatic ring in the spacer. discuss if this ring structure helps stabilize…
A: The presence of an aromatic ring in the spacer of a maleimide-based crosslinker can indeed…
Q: Why does Carr spend so much time explaining the plasticity or the brain? How does this information…
A: Carr spends a lot of time explaining the plasticity of the brain because he wants to show that our…
Q: studied how soil management affects bacterial production of B-glucosidase, an important enzyme that…
A: The synthesis of B-glucosidase by bacteria, a vital enzyme involved in the metabolism and breakdown…
Q: Natural Selection: Worksheet Imagine your anthropology professor studies a primate that eats…
A: A hypothesis is an explanation or prediction that has been proposed and can be tested through…
Q: Create an analysis chart of a sprinter that describes the qualitative movements, muscle…
A: Analyzing the movements, muscle contractions, and phases of a sprinter's hip joint provides valuable…
Q: What is the potential role of fungal endophytes in enhancing the stress tolerance of plant species…
A: Endophytes are microorganisms that live within a plant for part or all of their life cycle without…
Q: Question 92 Human red blood cells containing 0.9% sodium chloride are placed in a beaker containing…
A: Osmosis is the process by which solvent molecules, typically water, move across a semipermeable…
Q: C B D A the chloroplast C (single stack) outer membrane A inner membrane- B FREE MATERIAL…
A: The given diagram is of chloroplast which is an organelle present in plant cells.Chloroplast is a…
Q: What are the storage requirements for live seafood? (Answer true or false in space provided) Live…
A: Seafood refers to a variety of edible marine animals, including fish, shellfish, and mollusks, which…
Q: The function of the stop-transfer and start-transfer sequences is to make a transmembrane O globular…
A: A protein is a large biomolecule composed of one or more chains of amino acids. It is a fundamental…
Q: ↳ Moving to another question will save this response. Question 20 According to many previous…
A: Pancreatic cancer cells are harmful as they may expand and spread fast, which makes them difficult…
Q: 6) Pore-forming toxins are a class of protein-based toxic polymers that result in the formation of…
A: Pore-forming toxins are a class of protein-based polymers that have the ability to form large…
Q: when does DNA synthesis occur? a.
A: The cell cycle consists of several phases: G1 (Gap 1), S (Synthesis), G2 (Gap 2), and M…
Q: Mating of two organisms produces a 3:1 ratio of phenotypes in the progeny. Which of the following…
A: The crosses shown in the question are monohybrid cross that is these are concerned with only one…
Q: You are presented with the following clinical scenario: "A 50 year old patient presents with…
A: Various leukocyte populations can be distinguished using certain markers in flow cytometry studies…
Q: If a species of Agrobacterium had a mutation in the virG gene that prevents VirG from becoming…
A: Crown gall is a plant disease caused by certain strains of Agrobacterium particularly Agrobacterium…
Q: a) Which graph illustrates someone with diabetes? How do you know? ✓✓ b) Which graph illustrates…
A: Pancreas is an important organ that is part of our digestive system. It is…
Q: A scientist discovered a new group of unicellular organisms that lack mitochondria but possess an…
A: Mitochondria are membrane-bound organelles found in eukaryotic cells, and is involved in energy…
Q: look at the code: import random # Define the DNA nucleotides nucleotides = ["A", "T", "G", "C"] #…
A: import random# Define the DNA nucleotidesnucleotides = ["A", "T", "G", "C"]The above code defines…
Q: 1an example of a helical virus that infects humans. 2the first human virus discovered.
A: Viruses are the cunning organisms that are acellular in nature that doesnot undergo cell division…
Q: Anomers can be interconverted.... -by an isotopic exchange reaction -by rotation about…
A: When a sugar molecule undergoes cyclization, its carbon generates a new chiral center, and anomers…
Q: If the operator gene is a non-transcribable region of DNA, and the promoter is upstream of the…
A: What is an operon system?An operon is a genetic regulatory system found in prokaryotes (bacteria and…
Q: Question: The disorder: Red-Green color blindness • Explain the mode of inheritance of the disorder…
A: “Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: Answer all questions
A: We must determine the topic and area we should construct a hypothesis for before creating an…
Q: Epigenetic phenomena involve ODNA methylation and histone acetylation O genetic mutation chromosomal…
A: Epigenetic phenomena refer to heritable changes in gene expression that do not involve alterations…
Q: The loss of water from a plant by transpiration cools the leaf. Movement of water in transpiration…
A: In this answer, it aims to investigate the effect of substituting a nonpolar solution with similar…
Q: 5) The Laws of Thermodynamics state the energy cannot be created or destroyed If we consider that in…
A: The Laws of Thermodynamics state that energy cannot be created or destroyed, only transferred or…
Q: What are the different Pre-zygotic and Post-Zygotic Reproductive Barriers?
A: Acvording to our guideline we can answer only the first question with three subparts. You hava…
Q: Compare and contrast ‘bottom up’ versus ‘top down’ factors that limit population growth.
A: Population growth refers to the increase in the size or number of individuals within a population…
Q: 6. 7. Which is true regarding blood? A) Total blood volume is reduced with aerobic exercise training…
A: 1- Sports such as jogging, running and swimming are considered under the category of aerobic…
Q: TWO PART QUESTION PLEASE ANSWER BOTH THANKS The data below is the measured levels of percent…
A: The question is divided into two parts. In the first part (A), we are asked to create a graph…
Q: X, Y 5000 4000 3000 2000 cm³ 1000 0 cm² or q9 fig X Ľ Y 5 10 Body Size (radius in cm) 15 Y, X…
A: Both the surface area and volume of an organism change as it grows in size, but not at the same…
Q: 1. Imagine you are a student in Alfred Hershey and Martha Chase's lab in the late 1940s. You are…
A: DNA is a genetic material in almost all living organisms. DNA carries gene which passes from one…
Q: mmol CML/mol Lysine 2 () Lens Proteins (0) Skin Collagen
A: The chart displays the values for mmol CML/mol Lysine at different ages for lens proteins and skin…
Q: Small Lipids Atom Molecules Proteins Virus Bacteria 31 Only an electron microscope can be used to…
A: As per the guidelines of Bartleby, “Since you have posted multiple questions, we will provide the…
Q: Analogs of nucleotides are often used in studies of DNA. An analog is a modification of one of the…
A: Nucleotide analogs, are alterations of typical bases that can be joined into DNA and afterward…
Q: How does our current scientific understanding envision soil organic matter (SOM)? - SOM…
A: SOM stands for Soil Organic Matter. It refers to the organic component of soil, which includes a…
Q: What specific essential nutrient is required by a particular species of bacteria to survive and…
A: In the field of microbiology, the growth and proliferation of bacteria hinge significantly on the…
Q: Which of the following is not able to trap the energy from the sun to perform photosynthesis? O…
A: Photosynthesis: Green plants and certain other organisms convert light energy into chemical energy…
Q: For which of the following groups of animals is ascorbic acid considered an essential nutrient? O a.…
A: Essential nutrients are substances that are required for the normal functioning, growth,…
Q: Select all TRUE statements about the nuclear envelope: It is covered with ribosomes. It regulates…
A: A highly regulated membrane barriers that separates the nucleus from the cytoplasm which present in…
Q: Dragonfly Ladybird Greenfly Butterfly Berries Frog Snake Buzzard Titmouse Grasshopper Mouse Plantain…
A: A food chain is the sequence of actions in an ecosystem where one living organism consumes another…
Q: What are advantages and disadvantages of solid phase bioremediation technique?
A: As we know environmental pollution are rising day by day so the bioremediation is the best method to…
Q: Match each phase of the cell cycle on the left with the events that occur on the right. G1 S G2…
A: A series of steps where chromosomes and other cell materials are double to make their copies is…
Q: In contrast to prokaryotes, eukaryotic cells need multiple licensing factors to initiate…
A: Factor A: Cdt1 (Chromatin Licensing and DNA Replication Factor 1)Factor B: GemininFactor C: MCM…
Step by step
Solved in 3 steps
- Table I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the sequencce of RNA in which the protein product will be detrnemined. -What will be the protein product sqeuence? -What will be the pl of the protein product?
- Consider the following coding sequence transcribed from 5' to 3'5' A T G A A G C G C T C A G T A 3' If a guanine is substituted for nucleotide 11 what type of base substitution has occurred (nucleotide level) and what would be the resulting phenotypic effect?Given the partial transposons DNA sequence 5’-ACCGTATTCGGT-3’ upstream from the central region, assuming both terminal inverted repeats and flanking direct repeats have 6 base pairs, hypothetically write the transposon structure downstream from the central region.What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Enter just the number, nothing else! Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)
- For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand
- Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde / Human DNA sequence ATG TGT CCA TTA ACG TGC ACA Name the codon that is formed from base triplet number 2 on the DNA sequence. Write down the names of the amino acids coded for by base triplets 6 and 7. Write down the full names Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following: the amino terminus (N) the carboxyl terminus (C) a peptide bond an α-carbon atom If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed? E.The following is a sequence of base triplets in DNA F.If guanine, found in the first base…Draw the structure of the double Holliday junctionthat would result from strand invasion by both ends of thebroken duplex into the intact homologous duplex shownin Figure Q5–3. Label the left end of each strand in the Hol-liday junction 5ʹ or 3ʹ so that the relationship to the paren-tal and recombinant duplexes is clear. Indicate how DNAsynthesis would be used to fill in any single-strand gaps inyour double Holliday junction.Given: BamHI, cleaves after the first G: 5’ G GATCC 3’ 3’ CCTAG G 5’ AND BclI cleaves after the first T: 5’ T GATCA 3’ 3’ ACTAG T 5’ THEN -- Given the DNA shown below: 5’ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG3’ 3’TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC5’ i) If this DNA was cut with BamHI, how many DNA fragments would you expect? ii) If the DNA shown above was cut with the enzyme BclI, how many DNA fragment would you expect?