Use the numbers below to indicate the correct order of events (from left to right) during the process of translation initiation in bacteria.   large ribosomal subunit binds to the complex. IF3 is released. The small ribosomal subunit associated with IF1, IF2, and IF3 binds to the Shine-Dalgarno sequence on the mRNA. tRNA charged with f-methionine binds to the AUG codon at the P site. IF1 and IF2 are released, leaving the A site available for the second charged-tRNA to bind the codon at the A site.     3 1 5 4 2 2 1 4 5 3 1 3 5 2 4 3 4 2 1 5 4 2 1 3 5

Q: Which of the following is true for translation or protein synthesis in this cell? Select all that…

A: The translation is the process of synthesis of the polypeptide chain that can be taken place in…

Q: Which of the following statements about translation is false?     In eukaryotes, the 5' cap and…

A: In molecular biology, the process by which the gene information in the DNA gets converted into a…

Q: EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in…

A: Introduction The Central Dogma states the formation of RNA from DNA and proteins from RNA.  The…

Q: Which of the following types of mutations, resulting in a change in the mRNA just after the…

A: The translation process will result in the creation of proteins. The process of protein synthesis is…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation is a process through which a polypeptide chain is synthesized based on the sequence…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: The following picture drawing represents co-translation in E. coli. Answer the questions below the…

A: The question is to analyse the picture and answer the questions accordingly. Let's move on to the…

Q: The tRNA molecule carries EIF2 and GTP and binds the small ribosomal subunit at the P site in the…

A: During the process of translation which is the synthesis of proteins from mRNA translation…

Q: Which of the following does NOT happen during translation initiation? The mRNA binds to the small…

A: Translation: It is provess via which the protein is synthesized by the ribosomes after tye process…

Q: The piece of RNA below includes the region that codes for the binding site for the initiator tRNA…

A: Translation is a fundamental process in molecular biology that converts the genetic information…

Q: (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the…

A: The genetic code is a set of instructions that enable living cells to produce proteins from genetic…

Q: For each of the following initiation factors, how would eukaryoticinitiation of translation be…

A: Initiation factors are a kind of proteins, which bind to the smaller subunit of the ribosome. This…

Q: In the role of the P-site and A-site what is: The Processes in the Central Dogma. Identify where…

A: Of course, let's delve into each aspect in more detail:1. Processes in the Central Dogma:  -…

Q: The figure depicts what kind of splicing: A sequence change (asterisk) has abolished the acceptor…

A: Eukaryotic genomes possess a significant amount of cryptic splice sites.

Q: You are observing the translation process in a eukaryotic cell that has been exposed to an unknown…

A: Translation is the process by which the genetic information encoded in mRNA is used to synthesize…

Q: Explain the steps of RNA translation into protein.

A: “Since you have posted multiple questions, we will provide the solutiononly to the first question as…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: Translation process in cells includes the synthesis of proteins that are made up of amino acids.…

Q: Please describe the four-step process of the elongation during protein translation in bacteria.

A: Translation is  the process of formation of proteins from mRNA with the help of ribosomes in the…

Q: Which statement about nonsense mediated decay (NMD) is false? detects mRNAs containing premature…

A: "Since you have asked multiple questions, we will solve the first question for you. if you want any…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein…

Q: ) The deacetylation of histones generally causes gene inactivation. True or false?

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: For the following characteristics, state whether they are true for the 5' CAP, the Poly-A tail, BOTH…

A: Central dogma is the mechanism by which information of DNA is converted into a product (protein ) by…

Q: The following base sequence is a complete polynucleotide made in a bacterial cell. AUG, GCC, AUG,…

A: The process of transcription entails creating mRNA from a DNA template. A complementary mRNA strand…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: How does the antibiotic streptomycin inhibit bacterial translation? Multiple Choice blocks…

A: Translation Translation involves the answer of information in mrna molecules into the amino acid…

Q: Which of the following is the LAST to join the bacterial translation machinery during the initiation…

A: Translation refers to the process through which an mRNA sequence is converted into the corresponding…

Q: Describe the process where a peptide chain is formen from a code embedded in a nucleic acid…

A: Central Dogma of molecular Biology explain how a DNA replication result into DNA, DNA is changed…

Q: Describe in detail all of the steps necessary to carry out translation.  Amino acids, mRNA, 30S…

A: Translation is a complex process that requires many different molecules and steps. By understanding…

Q: What are the specific steps of eukaryotic translation? Be sure in your discussion that you include…

A: In transcription, a cell “copies” DNA sequence to a complementary RNA molecule. Then, in…

Q: Which of the following is the initiator tRNA for all bacterial proteins? O Formyl-cysteinyl-TRNAACG)…

A: Question - Which of the following is the initiator tRNA for all bacterial proteins?…

Q: Using the given information, determine the correct order of the following events during translation:

A:

Q: In the elongation stage of translation, which of the following options is correct? the polypeptide…

A: The Central Dogma of molecular biology refers to the flow of information from DNA to RNA to…

Q: The synthesis of a protein requires that the amino acids that constitute the growing polypeptide…

A: In the intricate dance of cellular processes, protein synthesis takes center stage, orchestrating…

Q: After the entire coding sequence of a protein has been decoded and the peptide chain is synthesized,…

A: Translation is a process of protein synthesis. It is completed in three steps-  Initiation…

Q: The figure below shows a ribosome in the process of translating an mRNA with a sequence:…

A: Translation is a process in which a single stranded RNA sequence formed at the end of transcription…

Q: The figure below shows the stage in translation when an incoming aminoacyl-tRNA has bound to the A…

A: Step-2:  The peptidyl transferase is a part of large subunit of ribosome (23S rRNA). It function as…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: "Place the following prokaryotic translation events in order: translocation, binding of initiator…

A: The correct answer to this particular question will be, assembly of small and large ribosomal…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation of m RNA to peptides occurs in the ribosomes. there are three different sites…

Q: Which eukaryotic initiation factor (elF) brings the initiator tRNA to the ribosome? elF1 1 O elF2…

A: The process by which the mRNA codes for a particular protein is known as Translation.

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.