Use the numbers below to indicate the correct order of events (from left to right) during the process of translation initiation in bacteria.   large ribosomal subunit binds to the complex. IF3 is released. The small ribosomal subunit associated with IF1, IF2, and IF3 binds to the Shine-Dalgarno sequence on the mRNA. tRNA charged with f-methionine binds to the AUG codon at the P site. IF1 and IF2 are released, leaving the A site available for the second charged-tRNA to bind the codon at the A site.     3 1 5 4 2 2 1 4 5 3 1 3 5 2 4 3 4 2 1 5 4 2 1 3 5

Q: What are the differences between translation and transcription in bacteria and eukaryotes? Give a…

A: Differences:                                     Bacteria…

Q: Which of the following is true for translation or protein synthesis in this cell? Select all that…

A: The translation is the process of synthesis of the polypeptide chain that can be taken place in…

Q: Which of the following statements about translation is false?     In eukaryotes, the 5' cap and…

A: In molecular biology, the process by which the gene information in the DNA gets converted into a…

Q: EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in…

A: Introduction The Central Dogma states the formation of RNA from DNA and proteins from RNA.  The…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: In bacterial genes, as soon as any partial mRNA transcript is produced by the RNA polymerase system,…

A:

Q: Describe in detail the steps of translation termination in bacteria. Explain what happe

A: For the synthesis of a polypeptide with a defined sequence, two fundamental chemical requirements…

Q: The tRNA molecule carries EIF2 and GTP and binds the small ribosomal subunit at the P site in the…

A: During the process of translation which is the synthesis of proteins from mRNA translation…

Q: Which of the following does NOT happen during translation initiation? The mRNA binds to the small…

A: Translation: It is provess via which the protein is synthesized by the ribosomes after tye process…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Indicate which of the following items are associated with transcription or translation.  This could…

A:

Q: For each of the following initiation factors, how would eukaryoticinitiation of translation be…

A: Initiation factors are a kind of proteins, which bind to the smaller subunit of the ribosome. This…

Q: In the role of the P-site and A-site what is: The Processes in the Central Dogma. Identify where…

A: Of course, let's delve into each aspect in more detail:1. Processes in the Central Dogma:  -…

Q: In eukaryotes, the initial transcript, pre-mRNA, must be modified in three ways before it leaves the…

A: The premature mRNA (pre-mRNA) are produced from the DNA template strand within the nucleus of…

Q: The figure depicts what kind of splicing: A sequence change (asterisk) has abolished the acceptor…

A: Eukaryotic genomes possess a significant amount of cryptic splice sites.

Q: You are observing the translation process in a eukaryotic cell that has been exposed to an unknown…

A: Translation is the process by which the genetic information encoded in mRNA is used to synthesize…

Q: Drag the functions involved in the bacterial translation process into the appropriate box with the…

A: IF1 Answer :  Prevents entry of an amino acyl trna into the ribosomeA site during the early initial…

Q: A mutation is found in a tRNA-encoding gene. The wild type (non-mutant) allele (version) produces a…

A: tRNA (transfer RNA) is a type of RNA that helps decode the genetic information in mRNA to build…

Q: Please describe the four-step process of the elongation during protein translation in bacteria.

A: Translation is  the process of formation of proteins from mRNA with the help of ribosomes in the…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein…

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: Determine whether each event occurs during initiation, elongation, or termination. Initiation…

A: The process of translation converts the information carried by messenger RNA from DNA into a…

Q: For the following characteristics, state whether they are true for the 5' CAP, the Poly-A tail, BOTH…

A: Central dogma is the mechanism by which information of DNA is converted into a product (protein ) by…

Q: The following base sequence is a complete polynucleotide made in a bacterial cell. AUG, GCC, AUG,…

A: The process of transcription entails creating mRNA from a DNA template. A complementary mRNA strand…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: How does the antibiotic streptomycin inhibit bacterial translation? Multiple Choice blocks…

A: Translation Translation involves the answer of information in mrna molecules into the amino acid…

Q: Which of the following is the LAST to join the bacterial translation machinery during the initiation…

A: Translation refers to the process through which an mRNA sequence is converted into the corresponding…

Q: The initial step in the protein translation is described by: O release of the initiation factors…

A: There are 4 Biomacromolecules. They are ; Proteins Nucleic acids Carbohydrates and  Lipids

Q: What are the specific steps of eukaryotic translation? Be sure in your discussion that you include…

A: In transcription, a cell “copies” DNA sequence to a complementary RNA molecule. Then, in…

Q: Which of the following is the initiator tRNA for all bacterial proteins? O Formyl-cysteinyl-TRNAACG)…

A: Question - Which of the following is the initiator tRNA for all bacterial proteins?…

Q: Using the given information, determine the correct order of the following events during translation:

A:

Q: Vaccina virus (used in the polio vaccine) produces an enzyme that takes the 5’ cap off of the mRNAs…

A: The 5'-G caping is only found in the eukaryotic mRNA. This is the result of post transcriptional…

Q: In the elongation stage of translation, which of the following options is correct? the polypeptide…

A: The Central Dogma of molecular biology refers to the flow of information from DNA to RNA to…

Q: Describe the prokaryotic translation initiation shown in the diagram. Define the convention of…

A: In bacteria initiation factor are required .Initiation factor 3(IF3) prevents 30S subunit binding to…

Q: The synthesis of a protein requires that the amino acids that constitute the growing polypeptide…

A: In the intricate dance of cellular processes, protein synthesis takes center stage, orchestrating…

Q: After the entire coding sequence of a protein has been decoded and the peptide chain is synthesized,…

A: Translation is a process of protein synthesis. It is completed in three steps-  Initiation…

Q: A segment of mRNA produced by the normal order of DNA nucleotides and the corresponding amino acid…

A: Introduction   Genetic code or codon is a three nucleotide sequence present on mRNA. It gives the…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.