c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3-GTTAGTACCT ТАCGGTACGAAGTATACTTАТCAAСTGTА-S' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. Second letter A G UAU Tyr UGC }cys UCU) UCC UCA UUG Leu UCG) UGU Phe UUC F UAC UAA Stop UGA Stop UAG Stop UGG Trp G Ser UUA CCU ССС CCA CG CUU CUC CỦA CAU His САС Pro CAA CGU CGC Arg Leu CGA Gin CG. CUG CAG AGU ser AGC AGA AAUAsn AUU AUC lle AUA AUG Met ACG ACU АСC ACA AAC Thr AAA AAG JLYS AGG JArg }Lys GCU GCC GCA GCG GGU GGC GGA GUU GAU1 Asp GAC GUC Val GUA Gly Ala GAA Glu GUG GAG, GGG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? DUAG Đ CAG Third letter DUAG UCAG 2. First letter

Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as if you were a ribosome, and write out the translation results. A genetic code table has been provided. mRNA: 5'- A C G U C C A A U G G C A G U G A U U U G A A U C C A -3'

Sequence 1 : TACGCTACGGTAATC Sequence 2: TACGCTACTATCGTA

The following mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA UCC UCC ACU CCU UGA-3' Use the following codons and the amino acids they encode: AUG = Start or Met; UUU, UUC = Phe; UUA, UUG = Leu; UCU, UCC = Ser; CCU, CCC = Pro; ACU, ACC = Thr; UGA = Stop. Select one: O a. Phe-Leu-Ser-Ser-Thr-Pro O b. Met-Phe-Leu-Ser-Ser-Thr-Pro O c. Thr-Phe-Thr-Phe-Leu-Ser-Ser-Thr-Pro Od. Met-Phe-Leu-Ser-Ser O e. Thr-Phe-Thr

Identify (and highlight or underline) the one nucleotide difference between the original (left) and altered (right) sequences

An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case.  What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’

mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…

An anticodon of tRNA has the sequence GCA. What amino acid does this tRNA carry? HINT: you use mRNA codons to read the genetic code chart.

Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.

If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- G