Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAiMet were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. Q. If the same experiment had been conducted on bacterial cells, what results would you expect?

Q: Yeast have 8 similar tRNA genes with the anticodon 5’-GUA. A researcher mutates one of these genes…

A: Tranafer RNA helps in transporting amino acid as per the instructions given by messenger RNA during…

Q: DNA in human mitochondria encodes 22 different tRNA molecules. However, 32 different tRNA molecules…

A: Mitochondrial gene expression maintain cellular homoeostasis. Mitochondrial gene expression is…

Q: The covalent attachment of an amino acid to a tRNA is an endergonic reaction. In other words, it…

A: Introduction  In the protein translation process, the key role is played by the tRNA which…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: The chemical bisulfite transforms cytosine (C) to uracil (U) (U). In DMSO, bisulfite is dissolved.…

A: Dimethyl sulfoxide is an organosulfur compound with the formula (CH₃)₂SO. The chemical bisulfite…

Q: A certain ochre suppressor inserts glutamine in response to the ochre codon. What is the most likely…

A: In this scenario, where a suppressor mutation allows the insertion of glutamine instead of…

Q: Some mitochondria use a second codon, in addition to AUG, to specify Met. Which codon(s) is (are)…

A: A codon refers to a specific sequence of deoxy ribonucleotide (DNA) or ribonucleic acid (RNA), which…

Q: Yeast have 8 similar tRNA genes with the anticodon 5'-GUA. A researcher mutates one of these genes…

A: Original Codon Decoded: The complementary codon to the anticodon was first decoded by the tRNA…

Q: How does the aminoacyl-tRNA synthetase that attaches the amino acid proline know which tRNA to…

A: tRNA is a small, well-characterized RNA molecule which plays a key role in protein biosynthesis.…

Q: For each of the following initiation factors, how would eukaryoticinitiation of translation be…

A: Initiation factors are a kind of proteins, which bind to the smaller subunit of the ribosome. This…

Q: You are observing the translation process in a eukaryotic cell that has been exposed to an unknown…

A: Translation is the process by which the genetic information encoded in mRNA is used to synthesize…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: What is the primary difference betwee class I and class II aminoacyl-tRNA synthetases.   a. Class…

A: An enzyme that synthesizes tRNAs by amino acid polymerization is called an aminoacyl-tRNA synthetase…

Q: The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and…

A: The genetic code can be defined as a set of rules. The information is encoded in the genetic…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein…

Q: ) The deacetylation of histones generally causes gene inactivation. True or false?

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: How does a eukaryotic ribosome select its start codon? Describe the sequences in eukaryotic mRNAs…

A: The biological mechanism by which messenger RNA is translated into proteins in eukaryotes is known…

Q: The 5′ region of the TPP riboswitch in Bacillus subtilis is very similar to the TPP riboswitch in E.…

A: Bacterias are genetically regulated by RNA, they use a ribonucleic acid sequence encoded within mRNA…

Q: Genetically engineered mRNAs that code for a stretch of basic residues, such as poly(Lys), induce…

A: Genetics is the branch of biology, which deals with the study of genes, their pattern of…

Q: The E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition…

A: E.coli is a type of bacteria that normally lives in the intestine. It is also found in the gut of…

Q: According to wobble rules, what codons should be recognized by the follow- ing anticodons? What…

A: Wobble pairing was defined as the base-pairing with two nucleotides that do not follow Watson-Crick…

Q: e nucleotide sequence of this anticodon loop under tant tRNA will, a) Recognize GCC as the codon for…

A: tRNA refers to transfer RNA. It helps in decoding an mRNA sequence into a protein. Three nucleotides…

Q: Using the given information, determine the correct order of the following events during translation:

A:

Q: The free energy of binding of codon on mRNA and anticodon on tRNA is -9 kT. What is the probability…

A: In thermodynamics, free energy is the function of internal energy, entropy, and enthalpy. The…

Q: ) Identify the current stage of the translation process shown in Figure 1 and name the anticodon…

A: Translation is a orocess in which mRNA produce  protein by the help of ribosome and tRNA.there are…

Q: The figure below shows a ribosome in the process of translating an mRNA with a sequence:…

A: Translation is a process in which a single stranded RNA sequence formed at the end of transcription…

Q: While helix-turn-helix (HTH) is known to be involved in both eukaryotic and prokaryotic…

A: helix-turn-helix (HTH) is a DNA-binding motif found in a variety of proteins, including…

Q: Describe how the base pairing between the Shine–Dalgarno sequence and the 30S subunit provides a…

A: The translation represents the process of protein synthesis by which the base sequence of the mRNA…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.