Describe how you could use CRISPR-Cas9 gene editing to alter a specific genomic DNA sequence in a eukaryotic organism in order to: A) knock out the gene, and B) change a single codon of the gene?
Q: Question- You have a new microorganism that you have just isolated. You suspect your bacterium is…
A: By recycling cellulose, the foremost abundant carbohydrate generated by plants, cellulolytic…
Q: Direction: On the worksheet, all the DNA sequences run from 3' to 5'. Supply the corresponding amino…
A: 3' TAC TCC GGC TCT CCC AGT TGA ACT 5' The sequence given is 3' to 5' sequence. Let us transcribe it…
Q: 18)(recall) RNA polymerase moves along the template strand of DNA in the DIRECTION, and adds…
A: As per the guidelines we are supposed to answer only the first question, in case of multiple…
Q: Would bacteria that have taken up a plasmid into which a DNA fragment has been inserted, form a blue…
A: Blue-white screening is a rapid and efficient technique for the identification of recombinant…
Q: Define the transcription unit. How does it differ from the gene? Describe how you would determine…
A: Succession of nucleotides in DNA that codes for a solitary RNA particle, alongside the arrangements…
Q: A- What are the topological parameters (linking number, twist, and writhe) for a relaxed, 4,200 base…
A: Relaxed DNA has unwound loop not supercoiled and the two strands twist around the helical axis once…
Q: Give the disadvantages of using cisplatin as an anti-cancer drug and give examples of how newer…
A: disadvantages of using cisplatin as an anti-cancer drug: Cisplatin is a chemotherapy drug used to…
Q: 1. Identify the gene from which the querysequence originates (Name of gene)
A: Hello. Since your question has multiple parts, we will solve first question for you. If you want…
Q: There is some recent research on the use of bacteriophages to inhibit pathogenic bacteria as…
A: Antibiotics are the drugs used to inhibit or kill bacteria.
Q: If you have 7 large DNA duplexes, how many TOTAL DNA duplexes will you have after 7 rounds of PCR…
A: * PCR or polymerase chain reaction is chemical reaction used to amplify the pieces of DNA. *Hence…
Q: Consider the λ bacteriophage DNA molecule as shown in Figure 21.14. Total digestion with the two…
A: DNA or deoxyribonucleic acid is a type of biomolecule. It is a polymer of deoxyribonucleotides…
Q: What must two different bacteria have in common for the same bacteriophage to be able to kill both…
A: A phage commonly known as bacteriophage is a type of virus that infects bacteria. The word "phage"…
Q: Site-directed mutagenesis involves: (MARK ALL THAT APPLY) Group of answer choices Joining two DNA…
A:
Q: 14) (recall) A particular triplet of bases in the template strand of DNA is AGT. The corresponding…
A: During the method of transcription, the data encoded inside the deoxyribonucleic acid sequence of 1…
Q: Question: Genetically modified animal that might be approved for human consumption is a super…
A: Introduction CRISPR stands for Clustered Regularly Interspaced Short Palindromic Repeats. This is…
Q: Question: What restriction sites are you going to add at the ends of the gene? Answer can be in…
A: The COVID-19 pandemic, also referred to as the coronavirus pandemic, is an ongoing global pandemic…
Q: Question:- How is the assembly of an antibody different than traditional forms of alternate…
A: Introduction: The B lymphocytes, which are antigenically activated, undergo blast transformation to…
Q: 67. To make an insertion using CRISPR Cas9, one must include a DNA with flanking sequences similar…
A:
Q: Which of the following is true of proto-oncogenes? They tend to be genes functioning in highly…
A: The answer is ''they tend to be genes functioning in highly differentiated cells''.
Q: Sequence alignment 1- Define the global and local alignments 2- What are the differences between…
A: The process of aligning two or more protein (or nucleic acid) sequences to establish amino acid…
Q: What is 16S rRNA? Group of answer choices -The ribonucleotide component of the 50S ribosomal subunit…
A: Note - Since you have asked multiple questions, we will solve the first question for you. If you…
Q: Whole-exome sequencing (WES) is helping physicians diagnose a genetic condition that has defied…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: What is genetic engineering? What organisms can it be performed on? Please give an example of at…
A: * Genetic engineering is also known as gene manipulation or modification. * It is a process to alter…
Q: ZFNs What is it? And how it works in genome editing?
A: Zinc-finger nucleases are counterfeit limitation catalysts (artificial restriction enzyme) produced…
Q: Why do some viruses encapsidate the viral RdRp yet other viruses rely on synthesizing the RdRp…
A: * Viral polymerases are important in viral genome replication and transcription. Based on genome…
Q: 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you…
A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…
Q: What direction does DNA polymerase extend and proofread DNA?
A: DNA Polymerase extends the DNA in 5' to 3' direction during replication. The proof reading property…
Q: compare these two techniques. Compare a nucleosome protection assay and a northern blotting is a…
A: Introduction: The nucleosome is the fundamental subunit of chromatin. Each of the tiny beads are…
Q: Question: What restriction sites are you going to add at the ends of the gene? Answer can be in…
A: INTRODUCTION The COVID-19 pandemic, also referred to as the coronavirus pandemic, is an ongoing…
Q: Can you briefly explain each types of mutation (difference, unique fact, etc) ? Please don’t just…
A: Mutations are the changes in the genome resulting in the synthesis of different products. These…
Q: 33. Genes for medically important proteins can be cloned and inserted into bacteria, as shown in the…
A: Recombinant DNA is a technique discovered by scientists that allows a human gene to be inserted into…
Q: Provide the consensus sequence for the first three actual sequences shown in Figure
A: Consensus sequences also known as canonical sequences can be determined by aligning nucleotide…
Q: Question: How does the interaction of covalent w/ hydrogen bonds and the structure of RNA encourage…
A: RNA bases form hydrogen bonds with complementary bases on the same strand forming hairpin loops. ...…
Q: How could multi-genes families complicate things in terms of using CRISPR to knock out a target gene…
A: Human body is a complex inter relation of all the biochemical and genetci expression. In a multi…
Q: null 1 points Save Answer What is the product of translation?Transcription of part of a DNA molecule…
A: 3) DNA CAA CAA CTT mRNA GUU GUU GAA Protein Val-Val-Glu From the information we can…
Q: what are the differences between mitochondrial RNA polymerase and RNA polymerase ? and why does…
A: *The mitochondrial transcription is a multi-component system consisting of, at minimum, the…
Q: Updates Sickle-cell hemoglobin differs from regular hemoglobin in just one amino acid. Normal…
A: Sickle cell anaemia is a genetic disease caused by an abnormal haemoglobin. The resulting change in…
Q: Explain briefly how bacteriophages causes mutation .
A: Bacteriophages (phages) are the most numerous organisms on the planet, yet very little learned…
Q: Recall that constructs used for floxing a gene contain,within one of the gene’s introns, two loxP…
A: In genetics, floxing refers to sandwiching the DNA sequence between two lox P sites. Lox P or…
Q: What information, and what reagents would you need to use PCR to detect HIV in a blood sample?
A: AIDS is caused by HIV, which impairs the body's ability to fight infections. Contact with infected…
Q: What is mutation? Distinguish between a gene mutation and a chromosomal mutation?
A: The genome is made up of one to several long DNA molecules, and mutations on these molecules can…
Q: In Bacteria, the UV-induced DNA damage will be repaired by ------- where -------- nitrogenous base…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: Describe how the Polycomb group proteins influence genome expression.
A: Polycomb proteins are first discovered in fruit flies I.e Drosophila melanogaster,during the…
Q: Reset Help defined as changes in the sequence of Mutations DNA frameshift mutations caused by…
A: a- mutagens (mutations caused by environmental factors) d- carcinogens (mutagens include cancer…
Q: Extra point question Antibiotic resistance can be acquired through many different mechanisms.…
A: Introduction In recombinant DNA technology, the antibiotic resistance principle is one of the prime…
Q: Chhose correct option plz QUESTION- The SARS-COV-2 virus interacts with a human protein present on…
A: The technique of altering DNA in an organism's genome is known as genetic engineering. Changes or…
Q: How does that length compare to that of restriction enzymes? Implications?
A: Answer- Restriction enzyme is also called as molecular sisscors because it is used to cut the DNA…
Q: Question: For bacterial gene transfer via conjugation to occur, the host bacterium must possess a…
A: The conjugation of the bacteria plasmids is called bacterial conjugation and in this here is direct…
Q: Expand PCR? Describe the different Steps involved in this technique?
A: PCR is an important technique in molecular Biology using which genes can be amplified easily. It…
Q: TALENs What is it? And how it works in genome editing? Including
A:
Question
Describe how you could use CRISPR-Cas9 gene editing to alter a specific genomic DNA sequence in a eukaryotic organism in order to: A) knock out the gene, and B) change a single codon of the gene?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- What advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications where the use of a genomic library is necessary to provide information that a cDNA library cannot.Question:- What is genetic engineering? What organisms can it be performed on? Please give an example of at least one successful genetic engineering project. Where was CRISPR/Cas9 initially found? What was its purpose in that organism?what is the main purpose of performing the bioinformatics analysis of 16s rRNA genes lab?
- Suppose your supervisor is working on a molecule “X” with UniProtKB accession number P18564. Being a team member in the project, you have been asked to provide the following information with high accuracy? I. Chromosome number: II. Protein size: III. Number of exons: IV. Stop codon: V. Size of the longest exon in nucleotidesWhole-exome sequencing (WES) is helping physicians diagnose a genetic condition that has defied diagnosis by traditional means. The implication here is that exons in the nuclear genome are sequenced in the hopes that, by comparison with the genomes of nonaffected individuals, a diagnosis might be revealed. (a) What are the strengths and weaknesses of this approach? (b) If you were ordering WES for a patient, would you also include an analysis of the patient’s mitochondrial genome?TOPIC: PCR and Gene Cloning Basics Question: What are 2 possible roles of CaCl2 in the transformation process?
- Recall that constructs used for floxing a gene contain,within one of the gene’s introns, two loxP sites flanking a gene for neomycin resistance (Fig. 18.11a). AloxP site is only 34 base pairs long, as shown in thefollowing figure.ATAACTTCGTATA ATGTATGC TATACGAAGTTATInverted repeat Spacer Inverted repeatExplain how you could use PCR to generate a neomycin resistance gene flanked by loxP sites, starting witha plasmid containing a neorgene. If you had the intronof the target gene cloned in a plasmid vector, howcould you insert your PCR product into the intron?BIOINFORMATICS Please solve the questions about(Akt 1) can use NCBI Please help me 1.What is the official genename of the gene? Do you have another names? 2.Find nucleotide sequence of reference sequence of your gene. 3.Find refseq transcript number of your gene. Make BLAST of two of refseq transcript. Show the Blast result. (You can take screenshots) 4.Find refseq protein sequence number of your gene. And download the amino acid sequence of your gene. 5.What is the chromosome number is it located? 6.What are the coordinates of the gene? 7.How many bp is the length of the transcript? (Hint: not RefSeq transcript) 8.What is the transcript access number? 9.How many exons and introns does it have? 10. What is the sequence of the first exon? 11.How many nucleotides long is each exon? 12. What is the UniProt accesion number of your genes for human?Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
- Transcriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment. (1) DNA sequencing (2) Allow for hybridization and wash excess cRNA. (3) Mix labeled cRNA with array chip. (4) PCR amplification (5) Measure fluorescence intensity to determine abundance of transcripts. (6) Add labeled cRNA at each microarray location. (7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts. (8) mRNA isolation from cells (9) Prepare fluorescently labeled cRNA probes (10) cDNA synthesisExperiment A microarray was hybridized with a mixture of two differentially labeled fluorescent cDNAs, one prepared using retinal RNA of 1-day-old mice (labeled with a green fluorescent dye) and the other prepared using retinal RNA of 28-day-old mice (red fluorescence). The two probes were prepared from identical amounts of retinal tissues and were mixed together for hybridization to the microarray. Unhybridized probes were washed away, and the microarray was photographed in a fluorescence microscope.Polymerase Chain Reaction (PCR) was invented by Kary Mullis in 1983. This technique had indeed facilitated research in various areas of molecular biology and genetics. You would like to amplify a particular gene fragment from the yeast genome using Polymerase Chain Reaction (PCR): (i) What is the major enzyme required to kick start this reaction? (ii) Besides the enzymes mentioned in Q2 (a)(), state three (3) other chemicals required for the amplification process to be carried out.