Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter ST.1, Problem 2DQ
Summary Introduction
To determine: The probability of finding a perfect match to a 20-
Introduction: PAM (protospacer adjacent motif) is defined by the 5’-NGG-3’ sequence where N refers to any nucleotide. This sequence helps the bacteria to distinguish bacterial DNA from foreign DNA.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
When an EcoR1 fragment, which represents the coding region of a human gene X, is cloned into the EcoR1 site upstream of the coding region of a prokaryotic gene (such as GST) (i.e., to make a X-GST fusion protein), what is the chance of an in-frame fusion? Please draw a diagram to explain your answer. Do you need to delete the stop codon of the X gene coding region before fusing it to the GST coding region? Please draw a diagram to explain your answer. Notes: It is NOT known which strand of the human gene X is the template strand for transcription. 2) Both X and GST protein fragments must be produced correctly)
The DNA-binding domain of each CREB protein subunit recognizes the sequence 5′–TGACGTCA–3′. Due to random chance, how often would you expect this sequence to occur in the human genome, which contains approximately 3 billion base pairs? Actually, only a few doze genes are activated by the CREB protein. Does the value of a few dozen agree with the number of random occurrences expected in the human genome? If the number of random occurrences of the sequence in the human genome is much higher than a few dozen, provide at least one explanation why the CREB protein is not activating more than a few dozen gene Actually, only a few doze genes are activated by the CREB protein. Does the value of a few dozen agree with the number of random occurrences expected in the human genome? If the number of random occurrences of the sequence in the human genome is much higher than a few dozen, provide at least one explanation why the CREB protein is not activating more than a few dozen gene
As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version.
1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explain
Chapter ST Solutions
Concepts of Genetics (12th Edition)
Ch. ST.1 - What is the difference between innate immunity and...Ch. ST.1 - What evidence demonstrates that CRISPR-Cas is an...Ch. ST.1 - Prob. 3RQCh. ST.1 - Why was the type II CRISPR-Cas9 system of S....Ch. ST.1 - Prob. 5RQCh. ST.1 - What is a single guide RNA, and what role does it...Ch. ST.1 - What is the difference between nonhomologous...Ch. ST.1 - Prob. 8RQCh. ST.1 - Prob. 9RQCh. ST.1 - Prob. 1DQ
Ch. ST.1 - Prob. 2DQCh. ST.1 - What ethical and safety considerations must be...Ch. ST.1 - Recall (from Chapter 18) how miRNAs and the...Ch. ST.1 - Describe two different ways in which engineered...Ch. ST.1 - Consider the following human genetic diseases:...Ch. ST.1 - What are the different concerns about off-target...Ch. ST.2 - What is VNTR profiling, and what are the...Ch. ST.2 - Prob. 2RQCh. ST.2 - Describe capillary electrophoresis. How does this...Ch. ST.2 - What are the advantages and limitations of...Ch. ST.2 - Prob. 5RQCh. ST.2 - Explain why mitochondrial DNA profiling is often...Ch. ST.2 - Prob. 7RQCh. ST.2 - Describe the database system known as CODIS. What...Ch. ST.2 - Prob. 9RQCh. ST.2 - Prob. 10RQCh. ST.2 - Given the possibility that synthetic DNA could be...Ch. ST.2 - Prob. 2DQCh. ST.2 - If you were acting as a defense lawyer in a murder...Ch. ST.2 - The phenomena of somatic mosaicism and chimerism...Ch. ST.3 - What is pharmacogenomics, and how does it differ...Ch. ST.3 - Describe how the drug Herceptin works. What types...Ch. ST.3 - Prob. 3RQCh. ST.3 - Prob. 4RQCh. ST.3 - Prob. 5RQCh. ST.3 - Prob. 6RQCh. ST.3 - Why is it necessary to examine gene-expression...Ch. ST.3 - Prob. 8RQCh. ST.3 - Prob. 1DQCh. ST.3 - Prob. 2DQCh. ST.3 - How can we ensure that a patients privacy is...Ch. ST.3 - As gene tests and genomic sequences become more...Ch. ST.4 - How do genetically modified organisms compare with...Ch. ST.4 - Prob. 2RQCh. ST.4 - Prob. 3RQCh. ST.4 - Prob. 4RQCh. ST.4 - Describe the mechanisms by which the Cry proteins...Ch. ST.4 - Prob. 6RQCh. ST.4 - Prob. 7RQCh. ST.4 - Describe how plants can be transformed using...Ch. ST.4 - How do positive and negative selection techniques...Ch. ST.4 - Prob. 10RQCh. ST.4 - What are the laws regulating the development,...Ch. ST.4 - Do you think that foods containing GM ingredients...Ch. ST.4 - Prob. 3DQCh. ST.5 - What is gene therapy?Ch. ST.5 - Prob. 2RQCh. ST.5 - When treating a person by gene therapy, is it...Ch. ST.5 - Describe two ways that therapeutic genes can be...Ch. ST.5 - Explain how viral vectors can be used for gene...Ch. ST.5 - Prob. 6RQCh. ST.5 - Explain an example of a successful gene therapy...Ch. ST.5 - Prob. 8RQCh. ST.5 - Prob. 9RQCh. ST.5 - Prob. 10RQCh. ST.5 - Prob. 11RQCh. ST.5 - Prob. 1DQCh. ST.5 - Who should be treated by gene therapy? What...Ch. ST.5 - The lifetime costs for treatment of conditions...Ch. ST.5 - Should CRISPR-Cas or other techniques be used for...Ch. ST.5 - Prob. 5DQCh. ST.6 - What are RFLP markers and how were they used to...Ch. ST.6 - Why was information from Nancy Wexlers large...Ch. ST.6 - How do aggregates of mHTT protein form?Ch. ST.6 - Why are the results from the inducible mouse model...Ch. ST.6 - Based on the results from mouse models, is it...Ch. ST.6 - What do the results from creating transgenic mice...Ch. ST.6 - What steps lead from the binding of the mHTT...Ch. ST.6 - Summarize the approaches to therapy designed to...Ch. ST.6 - There are nine known progressive neurodegenerative...Ch. ST.6 - Prob. 2DQCh. ST.6 - Prob. 3DQCh. ST.6 - Why is there an inverse correlation between the...Ch. ST.6 - Discuss the ethical issues raised by the use a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. (a) Give TWO possible causes of your protein becoming truncated. explainarrow_forwardIn the practical you have been analysing a human genomic library. You know from your calculations that only a small proportion of the human genome is represented, even when the entire class results are considered. Therefore, the chance of finding a particular single-copy gene in your library is very small. Outline a strategy for constructing a genomic DNA library more representative of the entire human genome. You will need to consider alternative vectors and the efficiency of transformation of the bacterial cells.arrow_forwardYou isolate a mouse Tau-gene-containing DNA fragment from the chicken and hybridize it to the freshly-made and isolated hnRNA (primary transcript) from the nucleus of the mouse cells transcribed from the Tau gene (immediately after it was produced), allowing no time for processing of the hnRNA. Describe what you see when you look at the DNA/RNA hybrid molecule under the electron microscope.arrow_forward
- in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.arrow_forwardWhich of the following set(s) of primers a-d could you use to amplify the following target DNA sequence, which is part of the last protein-coding exon of the CFTR gene? Explain briefly. (Note: The three dots represent the body of the region to be amplified, whose beginning and end are only being shown.) 5' GGCTAAGATCTGAATTTTCCGAG . TTGGGCAATAATGTAGCGCCTT 3' 3' CCGATTCTAGACTTAAAAGGCTC . AACCCGTTATTACATCGCGGAA 5' a. 5' GGAAAATTCAGATCTTAG 3'; 5' TGGGCAATAATGTAGCGC 3' b. 5' GCTAAGATCTGAATTTTC 3'; 3' ACCCGTTATTACATCGCG 5' c. 3' GATTCTAGACTTAAAGGC 5'; 3' АССCGTTATTАСАТСGCG 5 d. 5' GCTAAGATCTGAATTTTC 3'; 5' TGGGCAATAATGTAGCGC 3'arrow_forwardDescribe the outcome of a chain-terminator sequencing procedure in which (a) too few primers are present or (b) an excess of primers is present.arrow_forward
- Which of the following is NOT true of transposition? A) a replicative form of transposition is possible for DNA-only transposition B) flanking direct repeats are a by-product of transposition formed at the transposition site C) inverted repeats are formed in all types of transposons D long-terminal repeats are found in the class of retrotransposons that resemble retrovirusesarrow_forwardNow that you understand how the CRISPR-Cas9 system works, think back to the experiments discussed in the introduction to this chapter, in which researchers used CRISPR-Cas9 genome editing to treat mice with Duchenne muscular dystrophy. Why did the researchers choose to cut out the entire exon 23 in the mice with the disorder? Why not replace the specific mutation using a donor piece of DNA and homologous recombination? Propose some possible explanations.arrow_forwardThere is a hypothetical gene related to the nervous system of Drosophila. Describe all the methods, steps, and key substances you need to obtain to use the following techniques in experimental design to study the gene: - In situ hybridization (to find the mRNA) - Immunohistochemistry (to find the protein) - CRISPR-Cas9 (for loss of function) - Expression vector (for gain of function)arrow_forward
- The following DNA sequences found on the sense strand belong to the same eukaryotic gene: Sequence 1: 5'-GATTCAATAAAGCTCAGATCGCTCACGTCGCGACTC-3' Sequence 2: 5'-TCCGAGGTCACTAGATACTCGTCGATCGTATAAATG-3' a) Which sequence is likely to be found upstream from the coding sequence? Justify your answer. b) Which sequence is likely to be found downstream from the coding sequence? Justify your answer. c) Which sequence will not be transcribed into an mRNA transcript? Justify your answer.arrow_forwardIn chapter 19 of Watson et al., Box 19-2 explains the ChIP-Chip and ChIP-Seq techniques. Explain how can these techniques result in specific evidence for the combinatorial control of a eukaryotic gene?arrow_forwardA molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. He knows that the nucleotife sequence of a small part of the gene is GTGGACTGACA. Briefly explain how to obtain the desired gene.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license