Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 6, Problem 19P
Draw a replication bubble with both replication forks and label the origin of replication, the leading strands, lagging strands, and the 5'and 3' ends of all strands shown in your diagram.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Draw a diagram of a single replication fork. Label the following on your diagram:
1. All 3’-OH ends
2. All 5’-phosphate ends
3. leading strand (s)
4. lagging strand (s)
5. Okazaki fragments (draw 3) ❏ RNA primer(s)
6. direction of replication ❏ replisome(s)
7. origin (s)
8. terminus (i)
Given the diagram of the replication fork below,
indicate the chemical group (5'-P, 3'-P, 3'-OH or 5'-OH)
most likely to be found at the sites indicated below by the dots labeled A, B, and C.
The figure below depicts various elements of the eukaryotic replication machinery in action. Enter the name for the protein depicted
by each box.
Box A
Box B
Box C
Box D
Box E
Box F
DNA polymerase on
lagging strand (just
finishing an Okazaki
fragment)
F
Maintains polymerase association with DNA
Enzyme extends separation of DNA strands
Synthesizes RNA fragments that hybridize to DNA
Relaxes supercoiled DNA ahead of replication fork
Maintains DNA is single stranded state
Promotes binding of processivity factors to DNA
Newly synthesized strand
pocoar
Leading-strand template
A
New Okazaki fragment
RNA
primer
E
Lagging-strand
template
DNA polymerase
on leading strand
B
C
D
Saaragon
- Next Okazaki fragment
will start here
Parental DNA helix
Chapter 6 Solutions
Genetics: From Genes to Genomes
Ch. 6 - Griffith, in his 1928 experiments, demonstrated...Ch. 6 - Griffith, in his 1928 experiments, demonstrated...Ch. 6 - During bacterial transformation, DNA that enters a...Ch. 6 - Nitrogen and carbon are more abundant in proteins...Ch. 6 - If 30 of the bases in human DNA are A, a what...Ch. 6 - Which of the following statements are true about...Ch. 6 - Imagine you have three test tubes containing...Ch. 6 - What information about the structure of DNA was...Ch. 6 - A portion of one DNA strand of the human gene...Ch. 6 - When a double-stranded DNA molecule is exposed to...
Ch. 6 - A particular virus with DNA as its genetic...Ch. 6 - The underlying structure of DNA is very simple,...Ch. 6 - Prob. 13PCh. 6 - Bacterial transformation and bacteriophage...Ch. 6 - The CAP protein is shown bound to DNA in Fig....Ch. 6 - In Meselson and Stahls density shift experiments...Ch. 6 - When Meselson and Stahl grew E. coli in 15N medium...Ch. 6 - If you expose human tissue culture cells for...Ch. 6 - Draw a replication bubble with both replication...Ch. 6 - a. Do any strands of nucleic acid exist in nature...Ch. 6 - As Fig. 6.21 shows, DNA polymerase cleaves the...Ch. 6 - The bases of one of the strands of DNA in a region...Ch. 6 - Replicating structures in DNA can be observed in...Ch. 6 - Indicate the role of each of the following in DNA...Ch. 6 - Draw a diagram of replication that is occurring at...Ch. 6 - Figure 6.18 depicts Watson and Cricks initial...Ch. 6 - Researchers have discovered that during...Ch. 6 - A DNA synthesizer is a machine that uses automated...Ch. 6 - Bacterial cells were coinfected with two types of...Ch. 6 - A yeast strain with a mutant spo11- allele has...Ch. 6 - Imagine that you have done a cross between two...Ch. 6 - The Neurospora octad shown came from a cross...Ch. 6 - From a cross between e f g and e f g strains of...Ch. 6 - In Step 6 of Fig. 6.27, the resolvase enzyme...Ch. 6 - Figure 6.31shows four potential outcomes of...Ch. 6 - Each of the substrates for site-specific...Ch. 6 - Prob. 37PCh. 6 - Suppose that you could inject a wild-type mouse...Ch. 6 - C31 is a type of bacteriophage that infects...Ch. 6 - Cre is a recombinase enzyme encoded by a gene in...Ch. 6 - Like Cre/loxP recombination, site-specific...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Draw a replication origin in E. coli. Place the first 4 primers in the figure. Show how the replication would proceed. Label polarity of ALL template and growing (newly synthesized) strands. Show direction of synthesis on all growing strands and identify all leading and lagging strands (I do not want you to mention or describe the enzymes involved). please give answer asaparrow_forward(d) Write down the sequences of the templates that would give the tetranucleotides shown in I and II. In each case, label the 5' and 3' ends and indicate which template base is used first. (e) What difference would it make to bidirectional DNA replication if both modes of chain extension were equally favourable? I IIarrow_forwardBelow is a picture of a single origin of replication in a eukaryotic cell. 5' 3' 5' 1. On the figure above, Draw out where the following molecules will be located: Helicase; Sliding Clamp, Single Strand Binding Protein. 2. On the right hand side of the dotted line, the replication of which template strand (top or bottom) will be continuous by DNA polymerase? 3. On the left hand side of the dotted line, the complete replication of which template strand (top or bottom) will be more affected by a mutation that causes DNA ligase to be partially functional?arrow_forward
- A replication fork is shown below. The primary enzyme that catalyzes replication is [ Select ] . That enzyme also [ Select ] The leading strand would be the [ Select ] . Helicase is a(n) [ Select ] In this picture, helicase would be moving in the [ Select ] direction. 3' > >arrow_forwardSketch a LARGE labeled figure showing one replication fork and the synthesis of one leading strand and two lagging strands of DNA in the replication bubble. Label the 5’ and 3’ ends of all DNA strands shown in your figure. Also label any DNA polymerases, DNA helicases, primases and primers. (For this question you may assume that lagging strands have not been joined.)arrow_forwardIn the following diagram of a replication fork, primers are shown as thick black lines and newly synthesized DNA is shown as squiggly lines. Enzymes are shown as circles or boxes. Click on DNA polymerase I 3' 5' 7 c 34 % G Search or type URL 3' MacBook Pro & 5' + (: * II in 3 5' 3' +arrow_forward
- On the right of the replication fork, which DNA strand (top or bottom) will be the template for Okazaki fragment synthesis? What will be the leading strand DNA sequence from the region 1 (answer with DNA sequence)? The following origin of replication is found on E. coli chromosome. The DNA sequence of region 1 is shown below: Region I (Top strand): 5'....CTGACTGACA...3'. 5 < top ofi bottom Region 1 inarrow_forwardThe figure at the right shows a partially drawn replication fork. a) Annotate this figure to show the proper location of each of the following: • template DNA strand polarity • DNA polymerase I Topoisomerase (gyrase) • leading strand daughter fragment(s) lagging strand daughter fragment(s) Single stranded binding proteins • DNA polymerase III • Primase • Ligase • Helicasearrow_forwardThe sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forward
- Matching Type Choose the directionality of the given process. (4 points) What is the directionality of the given process? * 4 points 3'-5' 5'-3' Exonuclease activity Complementary strand of the continuous strand Addition of nucleotides going to the replication fork Addition of nucleotides away from the replication forkarrow_forwardThe proteins and enzymes listed below are all required for DNA replication in E. coli, but they are listed in a random order. Determine the correct order in which they function in replication, by selecting the correct number from the drop-down menu in each case, with 1 being first and 6 being last.arrow_forwardthis is the worst figure i have ever seen. Evidently A and B are different but the same color? From what I understand A would be a sliding clamp, and B is Primase? Is F rna primer (I think personally) or representing the SSBP? this is the worst diagram ever. the words that are for labeling are as follows: DNA polymerase III, sliding clamp, helicase, single-stranded binding protein (SSBPs), topoisomerase, RNA primer, newly synthesized DNA, primase, and DNA ligase.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY