Biological Science (6th Edition)
6th Edition
ISBN: 9780321976499
Author: Scott Freeman, Kim Quillin, Lizabeth Allison, Michael Black, Emily Taylor, Greg Podgorski, Jeff Carmichael
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 4, Problem 15PIAT
Summary Introduction
To review:
The Chargaff’s observations helped Watson and Crick to propose the complementary base pairing in double-stranded DNA model. The similar ratios of
Introduction:
Watson and Crick used Chargaff’s data of 1:1 between adenine:thymine (A:T) and guanine:cytosine (G:C) to establish the concept of complementary base pairing by DNA (deoxyribonucleic acid) double-helix model.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Watson and Crick used an approach called model building to deduce the structure of the DNA double helix.How does this differ from the more conventional experimental approach that is undertaken in a research laboratory? In this regard, why was the experiment of Meselsonand Stahl considered to be of such critical importance?
In the Watson-Crick DNA base pairing model, Adenine (A) binds to thymine (T), guanine (G) binds to cytosine (C).Draw the structures of thymine and adenine stabilized by Watson-Crick base pair interaction. Also draw the structure of the amide group of glutamine in an interaction of this T-A pair in a way that maximally satisfies the hydrogen bonding capacity of amide.
State the properties of the Watson-Crick model of DNA in the following categories:
a) number of polynucleotide chains
b) polarity (strand direction running same or opposite
c) bases on interior or exterior of molecule
d) sugar/phosphate on interior or exterior of molecule
e) which bases pair with which
f) right- or left-handed helix
Chapter 4 Solutions
Biological Science (6th Edition)
Ch. 4 - What are the four nitrogenous bases found in RNA?...Ch. 4 - 2. What determines the primary structure of a DNA...Ch. 4 - 3. Which of the following describes the synthesis...Ch. 4 - Prob. 4TYKCh. 4 - Prob. 5TYUCh. 4 - Prob. 6TYUCh. 4 - What would be the sequence of the strand of DNA...Ch. 4 - 8. According to the RNA world model, a ribozyme...Ch. 4 - Make a concept map (see BioSkills 12 ) that...Ch. 4 - Prob. 10TYPSS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In the Watson-Crick model for the DNA double helix (B form) the A-T and G-C base pairs share all but one of the following properties. Which is the exception? None of the proton-binding groups in the purine and pyrimidine bases is in its charged or ionized form. The plane of the base pair is roughly perpendicular to the axis of the helix in each case. The number of hydrogen bonds formed between the two bases of the base pair is the same. O The distance between the two glycosidic (base-sugar) bonds is the same in both base pairs, within a few tenths of an angstrom.arrow_forwardAccording to the Watson- Crick model how many polynucleotide chains does a DNA molecule have?arrow_forwardWhich of the following statements DOES NOT apply to the Watson and Crick model of DNA? a. The two strands of the DNA helix are anti-parallel. b. The distance between the strands of the helix is 20 angstroms (A). c. The framework of the helix consists of sugar-phosphate units of the nucleotides. d. The two strands of the helix are held together by covalent bonds. e. The purines are attracted to the pyrimidines. ...Explain your answer.arrow_forward
- The sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'arrow_forwardRecall the DNA’s three-dimensional model. The DNA is a right-handed helix wherein onecomplete 360 0 turn covers a distance of 34 angstroms (Å) or 3.4 nm and 10 base pairs. As a result, thebase pairs are separated by a distance of approximately 3.4 Å. The diameter of the Watson and CrickDNA molecule is 20 Å.Calculate the average number of nucleotide pairs (or base pairs) per micrometer of DNA doublehelix according to the dimension mentioned above. Round off your answer to the nearest wholenumber. Note also that 1 micrometer = 10,000 angstroms.arrow_forwardX-ray was used by Rosalind Franklin and Maurice Wilkins to study the molecular structure of DNA. Why is their finding not accepted by Watson and Crick? Explain.arrow_forward
- Recall the DNA’s three-dimensional model. The DNA is a right-handed helix wherein one complete 3600 turn covers a distance of 34 angstroms (Å) or 3.4 nm and 10 base pairs. As a result, the base pairs are separated by a distance of approximately 3.4 Å. The diameter of the Watson and Crick DNA molecule is 20 Å.Calculate the average number of nucleotide pairs (or base pairs) per micrometer of DNA double helix according to the dimension mentioned above. Round off your answer to the nearest whole number. Note also that 1 micrometer = 10,000 angstroms.arrow_forwardDraw the structure of the following DNA sequence (5’-AG-3’) hydrogen bonded through Watson-Crick base pairing to the complementary PNA sequence (Cterminus-TC-Nterminus). Make sure to include both the sugar phosphate backbone of your DNA sequence, as well as the peptide backbone of your PNA sequence. DNA: 5’-AG-3’ PNA: (C)-TC-(N)arrow_forwardYou have a sample of genetic material. The nitrogenous base content is 29% guanine. a) If the sample is DNA, what are the amounts of the other bases? Explain your thought process b) Why can you not determine the amounts of the other bases if the sample is RNA? Explain your answer c) How did Watson and Crick make use the relationships between base pairs as they constructed the model for DNA?arrow_forward
- To create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3', design the corresponding RNA sequence. Indicate the sequence in a 5' to 3' manner. What type of helix (A, B or Z) will this double-stranded nucleic acid form?arrow_forwardWhich positions in the purine ring of a purine nucleotide in DNAhave the potential to form hydrogen bonds but are not involved in Watson-Crick base pairing?arrow_forwardAs shown, five DnaA boxes are found within the origin of replication in E. coli. Take a look at these five sequences carefully. A. Are the sequences of the five DnaA boxes very similar to each other? (Hint: Remember that DNA is double-stranded; think about these sequences in the forward and reverse directions.) B. What is the most common sequence for a DnaA box? In other words, what is the most common base in the first position, second position, and so on until the ninth position? The most common sequence is called the consensus sequence. C. The E. coli chromosome is about 4.6 million bp long. Based on random chance, is it likely that the consensus sequence for a DnaA box occurs elsewhere in the E. coli chromosome? If so, why aren’t there multiple origins of replication in E. coli?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license