Biological Science (6th Edition)
6th Edition
ISBN: 9780321976499
Author: Scott Freeman, Kim Quillin, Lizabeth Allison, Michael Black, Emily Taylor, Greg Podgorski, Jeff Carmichael
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4, Problem 10TYPSS
Summary Introduction
To explain:
A model to illustrate how the two particles (a circle and a square) could be brought together by linking them to short single-stranded DNA (deoxyribonucleic acid) molecules.
Introduction:
The linking of two strands of DNA occurs by complementary base pairing. In the field of nanotechnology, DNA is used like Velcro to assemble tiny particles into structures that are < 0.0001 mm in size. If the DNA sequence linked to the circle is GGATC, then provide the sequence linked to the square and identify the 5′ and 3′ ends of each strand.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Try to propose structures for a genetic material that are substantiallydifferent from the double helix. Remember that the genetic material must have a way to store information and a way to be faithfully replicated.
Using the figure below identify:
What is a function of introns and exons?
What is a role of mobile DNA elements?
What is a meaning of simple-sequence DNA?
The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate
groups are filled circles.
A. Is this a DNA or an RNA Molecule?
B. Where is the 3’ end of this tetranucleotide?
C. Given that the DNA strand which served as a template for the synthesis of this
tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?
Chapter 4 Solutions
Biological Science (6th Edition)
Ch. 4 - What are the four nitrogenous bases found in RNA?...Ch. 4 - 2. What determines the primary structure of a DNA...Ch. 4 - 3. Which of the following describes the synthesis...Ch. 4 - Prob. 4TYKCh. 4 - Prob. 5TYUCh. 4 - Prob. 6TYUCh. 4 - What would be the sequence of the strand of DNA...Ch. 4 - 8. According to the RNA world model, a ribozyme...Ch. 4 - Make a concept map (see BioSkills 12 ) that...Ch. 4 - Prob. 10TYPSS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Explain in details the influence of ions and water (solvent) in stabilizing DNA structurearrow_forwardSuppose the following base sequence was found in a 20-base DNA polymer. 3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' end of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair? with respect to the G-C base pair? d. In the given segment in problem 1, illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragmentarrow_forwardLet’s say that you want to find out the difference in nucleotide sequence among two DNA strands, one of which is isolated from the liver of a liver cancer patient and the other one is isolated from the liver of a healthy individual. How you can do that, please explain in detailsarrow_forward
- During gel electrophoresis, DNA molecules can easily be separated according to size because all DNA molecules have the same charge-to-mass ratio and the same shape (long rod). Would you expect RNA molecules to behave in the same manner as DNA during gel electrophoresis? Why or why not?arrow_forwardThe complementarity of its two strands is the underlying reason that DNA can be faithfully copied. Propose alternative chemical structures that could be faithfully copied.arrow_forwardSingle-stranded binding proteins (SSBPs) bind to single-stranded DNA at the replication fork and prevent formation of short hairpin sequences that would otherwise impede DNA synthesis. What sorts of sequences in single-stranded DNA might be able to form a hairpin? Write out an example of a sequence that could form a 5-nucleotide hairpin loop, and draw it.arrow_forward
- Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?arrow_forwardThe sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'arrow_forwardGive typing answer with explanation and conclusion to all parts Maxim-Gilbert and Sanger Sequencing are two different methods used to sequence DNA. Describe the general techniques of Maxim-Gilbert and Sanger DNA Sequencing. List the advantages and disadvantages of each.arrow_forward
- Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).2.2. Describe what are missense mutations and its effects on structure and function using haemoglobin as an examplearrow_forwardTry to explain the function of DNA gyrase with a drawingarrow_forwardWrite out the DNA sequence using the following instructions: This is a double stranded DNA hydrogen bonding with each other following the principle of complementary base-pairing Each strand contains ten nucleotides Each strand contains all four different types of nucleotides You should indicate clearly the directionality of each strand in your answer You do not need to draw the full nucleotide structure. Use the one-letter code (A, T, G, C, or U) to represent each nucleotidearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY