Biological Science (6th Edition)
6th Edition
ISBN: 9780321976499
Author: Scott Freeman, Kim Quillin, Lizabeth Allison, Michael Black, Emily Taylor, Greg Podgorski, Jeff Carmichael
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 4, Problem 7TYU
What would be the sequence of the strand of DNA that is made from the following template: 5'-GATATCGAT-3'? (Your answer must be written 5' → 3'.) How would the sequence be different if RNA were made from this DNA template?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’ and Non-template strand = 5' - ATG-TCG-TGA-GTC-AGT - 3' .
If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
4th sequence (from the left) should be = TCG right?
The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you identify important features - capitalization does not affect the nucleotide indicated.
5' ...atacaATGcATGTCAaCTAcg[a]agatccgTAGaTAACATtCATatc...3'
a) Underneath that strand, write the sequence of the strand of DNA it would be paired with in a double-stranded helix. Use the single letter code A-adenosine, G-guanosine, T-thymine, C-cytosine, and U-uracil, and remember to label the 5' and 3' ends
b) Next, write the sequence of a possible mRNA transcript of the double-stranded DNA above. Remember that an mRNA must be translatable by a ribosome into a protein. Be sure to indicate 5' and 3' ends
c) Using the genetic code at the end, translate your mRNA into the appropriate protein. Write the amino acid sequence of the protein using the single letter amino acid code (also at the end) below the mRNA sequence in (b) and label the amino and carboxy terminals
d) Suppose the bracketed bold [a] were…
Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen.
xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx
Ditto, using this sequence
xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxx
Chapter 4 Solutions
Biological Science (6th Edition)
Ch. 4 - What are the four nitrogenous bases found in RNA?...Ch. 4 - 2. What determines the primary structure of a DNA...Ch. 4 - 3. Which of the following describes the synthesis...Ch. 4 - Prob. 4TYKCh. 4 - Prob. 5TYUCh. 4 - Prob. 6TYUCh. 4 - What would be the sequence of the strand of DNA...Ch. 4 - 8. According to the RNA world model, a ribozyme...Ch. 4 - Make a concept map (see BioSkills 12 ) that...Ch. 4 - Prob. 10TYPSS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forwardThe DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?arrow_forwardMake the complementary strand for the following DNA template and label both strands as 5’ to 3’ or 3’ to 5’ (hint: determine first if P = phosphate or –OH are the 5’ or 3’ end of the strand). Draw an arrow showing the direction of synthesis of the new strand. How many total hydrogen bonds are in this double strand of DNA? Template : P- AGACTTG-OH New strand :arrow_forward
- The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you identify important features – capitalization does not affect the nucleotide indicated. 5’…atacaATGcATGTCAaCTAcg[a]agatccgTAGaTAACATtCATatc…3’ a. Underneath that strand write the sequence of the strand of DNA it would be paired with in a doublestranded helix. Use the single letter code A-adenosine, G-guanosine, T-thymine, U-uracil and C-cytosine and remember to label the 5’ and 3’ ends. b. Next, write the sequence of a possible mRNA transcript of the double stranded DNA above. Remember that an mRNA must be translatable by a ribosome into a protein. Be sure to indicate 5’ and 3’ ends. c. Using the genetic code, translate your mRNA into the appropriate protein. Write the amino acid sequence of the protein below the mRNA sequence in (b) and label the amino and carboxy terminals d. Suppose the bracketed, bold [a] were mutated to be a t. Write the new sequence of your mRNA transcript…arrow_forwardMake the complementary strand for the following DNA template and label both strands as 5’ to 3’ or 3’ to 5’ (hint: determine first if P = phosphate or –OH are the 5’ or 3’ end of the strand). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA? Template : P- AGACTTG-OH New strand :arrow_forwardGiven the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid.arrow_forward
- If you had the RNA sequence below: 5' UUUGGAG3 and you were going to make a piece of DNA that would be a complement to it, what would the DNA sequence be? 5' 3'arrow_forwardA single (+) strand of DNA (base composition: A, 21%; G, 29%; C, 29%; T, 21%) is replicated by DNA polymerase to yield a complementary (-) strand. The resulting duplex DNA is then used a template by RNA polymerase, which transcribes the (-) strand. Indicate the base composition of the RNA formed.arrow_forwardLook at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’arrow_forward
- A single (+) strand of DNA (base composition: A, 21%; G, 29%; C, 29%; T, 21%) isreplicated by DNA polymerase to yield a complementary (−) strand. The resultingduplex DNA is then used a template by RNA polymerase, which transcribes the (−)strand. Indicate the base composition of the RNA formed.arrow_forwardThe sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide highlighted by the arrow. If the upper strand shown is the template strand, write the sequence you expect for the mRNA transcribed from this gene. Please write 5' to 3'. 5'-[x]-3' 5'-TACGTGACGGTAATACTAGC-3' 3'-ATGCACTGCCATTATGATCG-5'arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY