Give typing answer with explanation and conclusion to all parts Maxim-Gilbert and Sanger Sequencing are two different methods used to sequence DNA. Describe the general techniques of Maxim-Gilbert and Sanger DNA Sequencing. List the advantages and disadvantages of each.

Shown below are several next-generation sequencing reads from a sample you have. Which of the following is the most likely candidate for the original linear piece of DNA present in the sample that created the sequence reads shown below? 5' GGGCATTA 3' 5' TACGAACA 3' 5' ATACCGGGC 3' 5' ACCGTACG 3' 5' AACATACC 3'   Question 4 options:   5' ATTAACCGTACGAACATACCGGGC 3'   5' GGGCATTATACGAACAATACCGGGC 3'   5' ACCGGGCATTAACCGTACGAACAT 3'   5' AACATACCGGGCATTAACCGTACG 3'   5' GGCATTAACCGTACGAACATACCG 3'   5' ACCGTACGAACATACCGGGCATTA 3'

please solve this with step-by-step calculations and explanations.

You wish to align a 300 bp nucleotide sequence to a genome. Which of the following pairwise sequence alignment algorithms is BEST suited for this task? Global alignment or Local alignment? Please explain or elaborate why you chose this alignment algorithm.