An intron and exon term has to be defined. Concept Introduction: RNA synthesis: The process of RNA synthesis is Transcription. A small section of DNA unwinds, only one of the two strands act as template and the other strand as informational strand. The complementary bases are attached one by one by the action of RNA polymerase at template strand on moving down. The newly generated RNA is the exact copy of the informational strand, with the exception that a U replaces each T in the template DNA. The RNA synthesised carries genetic information and directs protein synthesis.

Question

Want to see the full answer?

Answer 1

Question

Chapter 26, Problem 26.52AP

Interpretation Introduction

Interpretation:

An intron and exon term has to be defined.

Concept Introduction:

RNA synthesis: The process of RNA synthesis is Transcription. A small section of DNA unwinds, only one of the two strands act as template and the other strand as informational strand. The complementary bases are attached one by one by the action of RNA polymerase at template strand on moving down. The newly generated RNA is the exact copy of the informational strand, with the exception that a U replaces each T in the template DNA. The RNA synthesised carries genetic information and directs protein synthesis.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Write the mRNA sequence (5′ to 3′) that would result from transcription of the DNA sequence. (Note: Ignore the colors)

As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________

Select all TRUE statements related to the process of transcription. More than one answer is possible. The enzyme helicase separates the complimentary base pairs that hold double-stranded DNA together. MRNA is formed by joining ribonucleotides that pair with the template strand of DNA MRNA is formed by joining ribonucleotides that pair with the coding strand of DNA exons are removed from MRNA. Okazaki fragments form on the lagging strand. introns are removed from mRNA. The enzyme DNA gyrase encompasses both strands of DNA and uncoils the helix of double-stranded DNA. transcription is the process by which MRNA codons are translated to proteins. MRNA formed will be complimentary to the coding strand. DNA is unwound to expose the targeted gene