Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 24, Problem 12EQ
Summary Introduction
To review:
A sequence of elements with two examples and the process of determination ofsequence elements by a computer program or by genetic studies.
Introduction:
Deoxyribonucleic acid (DNA) contains the genetic information about the organism and its sequencing is done to identify the order of each
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is a repetitive element in genomics? What are the types of repetitive elements? What is their effect on the ease of determining and analyzing a genome sequence?
In general, which part of a DNA sequence will have the best quality? (Ex. Beginning, middle, end?) Why?
The goal of many computer programs is to identify sequenceelements within a long segment of DNA. What is a sequenceelement? Give two examples. How is the specific sequence of asequence element determined? In other words, is it determined bythe computer program or by experimentation? Explain.
Chapter 24 Solutions
Genetics: Analysis and Principles
Ch. 24.1 - 1. A DNA microarray is a slide that is dotted...Ch. 24.1 - 2. The purpose of a ChIP-chip assay is to...Ch. 24.1 - 3. For the method of RNA sequencing (RNA-Seq),...Ch. 24.1 - A gene knockout is a gene a. whose function has...Ch. 24.2 - Prob. 1COMQCh. 24.2 - Prob. 2COMQCh. 24.2 - Prob. 3COMQCh. 24.2 - Prob. 4COMQCh. 24.3 - Prob. 1COMQCh. 24.3 - 2. Homologous genes
a. are derived from the same...
Ch. 24.3 - Prob. 3COMQCh. 24 - 1. Give the meanings of the following terms:...Ch. 24 - Prob. 2CONQCh. 24 - What is a database? What types of information are...Ch. 24 - Prob. 4CONQCh. 24 - Prob. 5CONQCh. 24 - Prob. 6CONQCh. 24 - Prob. 7CONQCh. 24 - Prob. 8CONQCh. 24 - Prob. 1EQCh. 24 - In the procedure called RNA sequencing (RNA-Seq),...Ch. 24 - 3. Can two-dimensional gel electrophoresis be used...Ch. 24 - Prob. 4EQCh. 24 - 5. Describe the two general types of protein...Ch. 24 - 6. Discuss the bioinformatics approaches that can...Ch. 24 - 7. What is a motif? Why is it useful for computer...Ch. 24 - Discuss why it is useful to search a database to...Ch. 24 - Prob. 9EQCh. 24 - In this chapter, we considered a computer program...Ch. 24 - Prob. 11EQCh. 24 - Prob. 12EQCh. 24 - Prob. 13EQCh. 24 - Refer to question 3 in More Genetic TIPS before...Ch. 24 - Prob. 15EQCh. 24 - Prob. 16EQCh. 24 - 1. Let’s suppose you are in charge of organizing...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The goal of many computer programs is to identify sequence elementswithin a long segment of DNA. What is a sequence element? Givetwo examples. How is the specific sequence of a sequence elementdetermined? In other words, is it determined by the computer programor by genetic studies? Explain.arrow_forwardA geneticist is interested in determining the locations of methylated cytosines within a fragment of DNA. She treats some copies of the fragment with sodium bisulfite and leaves some copies untreated. She then sequences the treated and untreated copies of the fragment and obtains the following results. Give the original sequence of the DNA fragment and indicate the locations of methylated cytosines. Sequence without treatment: — AATTGCCCGATCGATTAAGCCA — Sequence with treatment: — AATTGTTTGATCGATTAAGCTA —arrow_forwardWhy are closure and completeness important in genome sequencing?arrow_forward
- Give typing answer with explanation and conclusion to all parts Maxim-Gilbert and Sanger Sequencing are two different methods used to sequence DNA. Describe the general techniques of Maxim-Gilbert and Sanger DNA Sequencing. List the advantages and disadvantages of each.arrow_forwardWe have talked about several examples of cis-acting elements that have dyad symmetry (inverted repeat symmetry). Some function on the level of DNA, and others function on the level of RNA. Give one example of one that functions at the DNA level and briefly explain why the sequence requires dyad symmetry to work properly. Note: you don't have to give an exact sequence, just the name of the element. Edit View Incort Format Tools Tabloarrow_forwardE. How many nucleotides would be required to generate a polypeptide that is 15 amino acids long? This requires knowing how many nucleotides of DNA code for one amino acid. F. Assuming that there are between 20,000-25,000 genes in the human genome, do you think there are 1) fewer, 2) approximately the same number, or 3) more proteins in the human genome? Explain your answer.arrow_forward
- What are cis acting DNA sequences? List themarrow_forwardWhat is domain? And Why is it complicated to classify and study domains purely using sequence analysis?arrow_forwardWhich one of the following options would be a good way to identify the location of the poly A tail in the published DNA sequence for a gene? Look for AATAAA near the 3’ UTR of the DNA sequence. Look for TTTTTTTTTTTTTT… (many Ts) near the 3’ UTR of the DNA sequence. Look for AAAAAAAAAAA… (many As) near the 3’ UTR of the DNA sequence. Look for a stop codon.arrow_forward
- Examine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be able to amplify this entire DNA fragment. Your answer must fulfill the following criteria: Design the primers so that they are each 7 bases in length. Please write out the sequence of these primers. Don’t forget to indicate the direction (polarity) of both ends of each primer. Note that only the polarity of one end of one of the template strands of DNA is provided below. Describe where the primer would bind (i.e. top or bottom template strand, left or right side of the DNA strand) Organize your response so that each primer, and associated information, is separated by at least one blank linearrow_forwardA compact disc (CD) stores about 4.8 × 109 bits of information in a 96 cm2 area. This information is stored as a binary code—that is, every bit is either a 0 or a 1. how many bits would it take to specify each nucleotide pair in a DNA sequence? how many CDs would it take to store the information contained in the human genome?arrow_forwardBelow is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License