Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 24, Problem 11EQ
Summary Introduction
To review:
The use of pattern recognition, sequence recognition or both to identify the following:
A. The presence of P element in the Drosophila.
B. The presence of stop codon in a stretch of DNA (deoxyribonucleic acid).
C. The presence of an inverted sequence in one segment with respect to the other.
D. The presence of one or more genes in a long stretch of bacterial DNA.
Introduction:
With the advancement of technology, the gene of interest can be easily searched in a genome that has been newly sequenced, in case the sequence of gene is known. Using this approach, genes with known functions can be identified in the newly sequenced genome, thus helping in the genome annotation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
a molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answer
Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?
Consider the following gene with their respective introns and exons
5’ – TCATGCATTTTGCGCGGGAAATAGCTCA – 3’
3’ – AGTACGTAAAACGCGCCCTTTATCGAGT – 5’
Using the bottom as a template strand, create:
A. A primary mRNA transcript B. A processed mRNA transcriptC. Highlight where your START and STOP codons are in your processed transcript (if there are any). D. The resulting protein sequence
Chapter 24 Solutions
Genetics: Analysis and Principles
Ch. 24.1 - 1. A DNA microarray is a slide that is dotted...Ch. 24.1 - 2. The purpose of a ChIP-chip assay is to...Ch. 24.1 - 3. For the method of RNA sequencing (RNA-Seq),...Ch. 24.1 - A gene knockout is a gene a. whose function has...Ch. 24.2 - Prob. 1COMQCh. 24.2 - Prob. 2COMQCh. 24.2 - Prob. 3COMQCh. 24.2 - Prob. 4COMQCh. 24.3 - Prob. 1COMQCh. 24.3 - 2. Homologous genes
a. are derived from the same...
Ch. 24.3 - Prob. 3COMQCh. 24 - 1. Give the meanings of the following terms:...Ch. 24 - Prob. 2CONQCh. 24 - What is a database? What types of information are...Ch. 24 - Prob. 4CONQCh. 24 - Prob. 5CONQCh. 24 - Prob. 6CONQCh. 24 - Prob. 7CONQCh. 24 - Prob. 8CONQCh. 24 - Prob. 1EQCh. 24 - In the procedure called RNA sequencing (RNA-Seq),...Ch. 24 - 3. Can two-dimensional gel electrophoresis be used...Ch. 24 - Prob. 4EQCh. 24 - 5. Describe the two general types of protein...Ch. 24 - 6. Discuss the bioinformatics approaches that can...Ch. 24 - 7. What is a motif? Why is it useful for computer...Ch. 24 - Discuss why it is useful to search a database to...Ch. 24 - Prob. 9EQCh. 24 - In this chapter, we considered a computer program...Ch. 24 - Prob. 11EQCh. 24 - Prob. 12EQCh. 24 - Prob. 13EQCh. 24 - Refer to question 3 in More Genetic TIPS before...Ch. 24 - Prob. 15EQCh. 24 - Prob. 16EQCh. 24 - 1. Let’s suppose you are in charge of organizing...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- After Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun” technique, every DNA sequence of Drosophila in a library can be recovered.a. How would you identify a clone that contains DNA encoding the protein actin, whose amino acid sequence is known?b. How would you identify a clone encoding a specific tRNA?arrow_forward1)A. how do you read a sequence of DNA (template or non-template strand) to convert it an mRNA sequence and to a protein? B.How does chromatin remodeling regulate gene transcription? C. What are the major differences between gene expression in bacteria and eukaryotes D. How are non-coding regions involved in gene transcription? E. Explain how eukaryotic genes sometimes produce multiple protein products?arrow_forwardYou would like to add a nuclear localization sequence (NLS) of Lys-Lys-Lys-Arg-Lys to a protein that is usually found in the cytoplasm of a yeast cell. To accomplish this, you introduce the nucleotide sequence encoding the NLS into the gene that encodes the cytoplasmic protein of interest. a. What is the size of the nucleotide insert that will encode the NLS? Briefly explain. 5' 3' b. Below is a diagram of the gene encoding the cytoplasmic protein of interest in the yeast genome. If your goal is to put the NLS at the carboxyl (C) terminus of the protein, at which location (A-E) should the NLS be inserted? Briefly explain. A TATAA ATATT promoter +1 B ATG TAC D TAA ATT stop codon E 3' 5'arrow_forward
- Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?arrow_forwarda. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? b. If a single transversion occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? c. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence? d. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?arrow_forwardYou are studying a large eukaryotic gene that is 439,515 base pairs long. You find the polypeptide that this gene produces in liver cells is 46,771 amino acids long. Your colleague studies the function of this gene in brain cells, and finds the polypeptide produced in the brain is much larger – 61,438 amino acids long. How do you explain this difference? Possible Answers: A. The cell cycle of liver cells is much longer than that of brain cells. B. This is due to alternative splicing. in the brain C. There was a different complement of sequence-specific transcription factor binding sites in the CRM of the brain cells. D. There is no 5' cap added to the gene product from the liver cells.arrow_forward
- Perfect Day Foods is one company creating a synthetic milk alternative. It's similar to milk in that it consists of casein and whey, the proteins found in milk. However, a cow was never used to produce their product. Instead, the animal-free dairy product is made in a lab using yeast programmed with DNA to produce the same proteins found in cow’s milk. a. Describe the technology that was used to generate yeast programmed to produce milk proteins.arrow_forwardThe template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?arrow_forwardIn the table below, there are four versions of gene A, one of which is normal, and the other three which contain mutations that make the gene product nonfunctional. Focus on the shaded region of the sequence. Use the genetic code table to answer the question. How would you describe Mutation #2? Partial DNA sequence for gene A ("..." indicates many nucleotides of sequence not shown) 5' ... ATG GTG AGC AAG GAG GAG CTG TTC ACC TGT AAA TAG ... Normal Mutation #1 5' ... ATG GTG AGC AAG GAG AAG CTG TTC ACC TGT AAA TAG ... Mutation #2 5' ... ATG GTG AGC AAG TAG GAG CTG TTC ACC TGT AAA TAG ... Mutation #3 5' ... ATG GTG AGC AAG GAG CTG TTC ACC TGT AAA TAG ... Silent mutation Nonsense mutation Frameshift mutations Missense mútationarrow_forward
- DNA from a eukaryotic gene was isolated, denatured, and hybridized to the mRNA transcribed from the gene; the hybridized structure was then observed with an electron microscope. The adjoining diagram shows the structure that was observed. a. Identify and label the exons and introns in this hybridized structure.arrow_forwardCpG is an epigenetic term that means: Select one: a. The binding of cytosine with the following guanine on the anti-sense strand b. The binding of the sense cytosine with guanine on the antisense DNA strand c. The binding of cytosine to guanine on the same strand by hydrogen bonds d. The binding of cytosine to guanine on the same strand by phosphodiester bond e. The binding of cytosine to guanine on the opposite strandarrow_forwardThe following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene Z and the underlined and italicized sequence encodes the gene Z ribosome binding (RBS) site. Transcription begins at and includes the T/A base pair at position 60 (bold). a. What are the nucleotides of the mRNA from gene Z?b. What are the amino acids encoded by gene Z? (A codon chart is found on the final page)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY