The given sequence of nucleotide from a gene and determine the gene along with the species in which the gene sequence is found. Introduction: Genes are made up of deoxyribonucleic acid (DNA). Genes are generally described as the basic, functional, and physical unit of life. Genes do not code for the proteins but they instruct the other molecules to synthesize the proteins. Proteins are the building blocks of the body, made by the polymerization of amino acids.

Question

Want to see the full answer?

Answer 1

Question

Definition Definition Chemical process in which one or more monomers combine to produce a very large chain-like molecule called a polymer. The functional groups present on the monomers and their steric effects are responsible for polymerization through a sequence of reactions that vary in complexity. There exists a stable covalent chemical bond between monomers that sets apart polymerization from other processes.

Chapter 24, Problem 15EQ

Summary Introduction

To analyze:

The given sequence of nucleotide from a gene and determine the gene along with the species in which the gene sequence is found.

Introduction:

Genes are made up of deoxyribonucleic acid (DNA). Genes are generally described as the basic, functional, and physical unit of life. Genes do not code for the proteins but they instruct the other molecules to synthesize the proteins. Proteins are the building blocks of the body, made by the polymerization of amino acids.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

What organism produced this gene sequence? Provide the full genus and species name. Make sure to spell it correctly! (Hint: Use "standard database" and not the "TRNA database" in your search.) >Sequence2c GCGGTTCCACAAGACCCTGAGGCGCCTGGTGCCTGACTCGGACGTCCGGTTCCTCCTCTC

Identify the MRNA sequence that encodes the protein Design primers that will allow them to amplify the gene sequence using PCR.

An example sequence corresponds to human sickle cell beta-globin mRNA and that this disease results from a point mutation in the β globin gene. In the following section, you will compare sickle cell and normal β globin sequences to reveal the nature of the sickle cell mutation at the protein level. To do this you need to find at least one sequence representing the normal beta globin gene. Open a new window and visit the NCBI home page(http://www.ncbi.nlm.nih.gov) and select “Nucleotide” from the drop menu associated with the top search box. Then enter the search term: HBB . Note that lots of irrelevant results are returned so let's apply some “Filters” (available by clicking in the left-hand sidebar) to focus on RefSeq entries for Homo sapiens. Remember that we are after mRNA so we can compare to the mRNA sequence from part 1 above. QUESTION #1: What is the ACCESSION number of the “Homo sapiens hemoglobin, beta (HBB), mRNA” entry? NOTE: Boolean operators (NOT, AND, OR) as…

Answer 2

Question

Definition Definition Chemical process in which one or more monomers combine to produce a very large chain-like molecule called a polymer. The functional groups present on the monomers and their steric effects are responsible for polymerization through a sequence of reactions that vary in complexity. There exists a stable covalent chemical bond between monomers that sets apart polymerization from other processes.

Chapter 24, Problem 15EQ

Summary Introduction

To analyze:

The given sequence of nucleotide from a gene and determine the gene along with the species in which the gene sequence is found.

Introduction:

Genes are made up of deoxyribonucleic acid (DNA). Genes are generally described as the basic, functional, and physical unit of life. Genes do not code for the proteins but they instruct the other molecules to synthesize the proteins. Proteins are the building blocks of the body, made by the polymerization of amino acids.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Definition Definition Chemical process in which one or more monomers combine to produce a very large chain-like molecule called a polymer. The functional groups present on the monomers and their steric effects are responsible for polymerization through a sequence of reactions that vary in complexity. There exists a stable covalent chemical bond between monomers that sets apart polymerization from other processes.

Chapter 24, Problem 15EQ

Summary Introduction

To analyze:

The given sequence of nucleotide from a gene and determine the gene along with the species in which the gene sequence is found.

Introduction:

Genes are made up of deoxyribonucleic acid (DNA). Genes are generally described as the basic, functional, and physical unit of life. Genes do not code for the proteins but they instruct the other molecules to synthesize the proteins. Proteins are the building blocks of the body, made by the polymerization of amino acids.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Definition Definition Chemical process in which one or more monomers combine to produce a very large chain-like molecule called a polymer. The functional groups present on the monomers and their steric effects are responsible for polymerization through a sequence of reactions that vary in complexity. There exists a stable covalent chemical bond between monomers that sets apart polymerization from other processes.

Chapter 24, Problem 15EQ

Summary Introduction