Biology
12th Edition
ISBN: 9780134813448
Author: Audesirk, Teresa, Gerald, Byers, Bruce E.
Publisher: Pearson,
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14.5, Problem 1CSC
Many countries regulate the use of genetically modified organisms, and enforcing the regulations requires methods of distinguishing modified and unmodified organisms whose outward appearances may be very similar. Some of the most effective methods are similar to the DNA profiling used in criminal investigations. For example, investigators in Europe routinely test crop samples by using PCR of target loci followed by gel electrophoresis to produce DNA profiles much like those used to identify criminals. These profiles are compared to those in a database of profiles from samples known to be either normal or genetically modified.
What kinds of genetically modified organisms are the European investigators trying to detect?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
RECOMBINANT DNA
BRIEFLY, DESCRIBE RECOMBINANT DNA AND GIVE ONE CONCRETE EXAMPLE. EVALUATE THE SIGNIFICANCE/PRACTICAL APPLICATIONS OF THIS DNA TECHNOLOGY BY CONSIDERING ETHICAL AND MORAL IMPLICATIONS BEHIND IT.
RECOMBINANT DNA
EXAMPLE:
MODIFIED TRAIT
GENE MODIFICATION
RECIPIENT ORGANISM
FIELDS OF APPLICATION
ALSO, WHAT ARE YOUR INSIGHTS? IN 2 TO 3 SENTENCES.
the hurdles that must be cleared before a new DNA profiling methodology can be used is....
A laboratory must demonstrate that it has achieved an error rate of zero with the methodology using samples that mimic those it encounters in casework.
A lab needs to develop standard operating procedures and proficiency tests for its analysts. The technique must also be approved by an independent accrediting agency.
A lab needs to invest in equipment, validation, the development of standard operating procedures, and training. The technique must also be determined to be admissible after Frye and Daubert hearings.
Scientists working in an academic setting must first prepare the methodology for use in crime laboratories by developing test kits. Labs must then independently validate commercially available kits.
Private crime laboratories can use new methodologies at any time but state/public crime laboratories must…
Please answer these two questions regarding PCR:
a) Why do you need to perform PCR on DNA obtained from a crime scene?
b) Why so forensic labs analyze non-coding DNA rather than genes?
Chapter 14 Solutions
Biology
Ch. 14.1 - define biotechnology?Ch. 14.1 - Prob. 2CYLCh. 14.1 - define GMO and transgenic organism?Ch. 14.2 - describe natural processes that recombine DNA,...Ch. 14.3 - Prob. 1CSCCh. 14.3 - Prob. 1CYLCh. 14.3 - summarize how CRISPR-Cas9 works and explain why it...Ch. 14.4 - For any single person, a given STR always has...Ch. 14.4 - There are many other applications in which DNA...Ch. 14.4 - Prob. 1CYL
Ch. 14.4 - Prob. 2CYLCh. 14.5 - Restriction enzymes are isolated from bacteria....Ch. 14.5 - Many countries regulate the use of genetically...Ch. 14.5 - explain how genes are inserted into a plasmid, and...Ch. 14.5 - Prob. 2CYLCh. 14.6 - Prob. 1CTCh. 14.6 - Prob. 1HYEWCh. 14.6 - describe the advantages of genetically modified...Ch. 14.6 - list some examples of how genetically modified...Ch. 14.6 - Prob. 3CYLCh. 14.7 - Explain how fetal DNA could be used to establish...Ch. 14.7 - explain how biotechnology is used to diagnose both...Ch. 14.7 - describe how transgenic organisms are used to...Ch. 14.7 - describe the procedures and advantages of gene...Ch. 14.8 - explain why people might be opposed to the use of...Ch. 14.8 - Prob. 2CYLCh. 14.8 - Prob. 1CTCh. 14 - Prob. 1MCCh. 14 - Prob. 3MCCh. 14 - A restriction enzyme a. cuts DNA at a specific...Ch. 14 - Prob. 5MCCh. 14 - Prob. 1FIBCh. 14 - _________is the process whereby bacteria pick up...Ch. 14 - The _______ is a technique tor multiplying DNA in...Ch. 14 - Matching DNA samples in forensics uses a specific...Ch. 14 - Prob. 5FIBCh. 14 - Describe two natural forms of genetic...Ch. 14 - Prob. 2RQCh. 14 - Prob. 3RQCh. 14 - Prob. 4RQCh. 14 - Prob. 5RQCh. 14 - Prob. 6RQCh. 14 - How does gel electrophoresis separate pieces of...Ch. 14 - Prob. 8RQCh. 14 - Prob. 9RQCh. 14 - Prob. 10RQCh. 14 - As you may know, many Insects have evolved...Ch. 14 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Brenda is a junior student in the biomedical program at her school. She is starting the PCR genetic testing lab activity. She is about to obtain her DNA sample but doesn’t want like the taste of NaCl solution. Her friend, Mark, let her use some of his DNA. What laboratory tule did the students break? A. Obtaining and handling DNA sample without wearing googles or gloves B. Improper use of human DNA samples C. Violating Patient Confidentiality D. Disposing of bio hazardous material in a regular trasharrow_forwardDiscuss the uses of PCR and RT-PCR in human identity (e.g. paternity, forensics or criminal cases) as well as in viral or bacterial DNA/RNA analysis (i.e. Identification of SARS-COV-2 RNA coronavirus using RT-PCR).arrow_forwardPrimer annealing is an important aspect of PCR. The annealing step of the cycle usually takes place at around 45-55°C and lasts for only 20-30 seconds. Which of the following statements best explains why the annealing time has to be so brief? OA. A longer annealing time would prevent primers binding to specific sites. OB. The short time frame prevents primers from binding to each other. OC. If the time were any longer, DNA polymerase would begin to denature. OD. The short time frame minimizes complementary template strands base pairing with each other. Reset Selectionarrow_forward
- Which of the following is/are true regarding a PCR reaction performed to amplify a DNA plasmid? There may be more than one correct answer; select all that apply. Two primers are needed to facilitate double stranded DNA extension. Denaturation, when the primers bind to the DNA template, is performed at the highest temperature. Extension is the step when the polymerase catalyzes nucleotide incorporation during polymerization. ATP, UTP, GTP, and CTP are all required for polymerization.arrow_forwardThe idea behind PCR-based diagnostics is that a very small number of microbial genomes in a patient sample can be multiplied by PCR and more easily detected by the clinical team managing the patient’s care. Also, genetic-based diagnostics are very useful for viral infections because we don’t have biochemical tests, etc. to distinguish one virus from another (remember, viruses are metabolically inactive). However, a lot of work goes into the development of these tests. For instance, PCR requires primers that are complementary to the viral genome that is being copied. If primers are complementary to the target genome, what must scientists know to design primers that bind to the viral genome to be copied? (I mean this to be a general question; don’t look up the details of designing primers)arrow_forwardWhich is a complete list of the ingredients that are essential for PCR? nucleotides, DNA template, Taq polymerase, and plasmids nucleotides, DNA template, DNA ligase, and plasmids nucleotides, DNA template, Taq polymerase, and primers restriction enzymes, DNA template, Taq polymerase, and primers nucleotides, DNA template, DNA ligase, and primersarrow_forward
- Which of the following criteria do you feel is the most important one to optimize for a DNA profiling methods? Speed Discriminating power Sensitivity Cost False Positive Ratearrow_forwardA student is trying to add 15.0 ng of DNA template to a 20.0 µL PCR. The DNA template is at a concentration of 65.0 ng µL-1, and the student determines that a serial dilution is required because directly adding the DNA template would require a volume less than 1.00 µL. The student wants to prepare an intermediate solution at a concentration of 15.0 ng µL-1. If the DNA template stock will be mixed with 13.0 µL of ultrapure H2O, calculate the volume (in µL) of the DNA template required to prepare the intermediate solution.arrow_forwardName the five key tools for accomplishing the tasks of recombinant DNA technology.also mention the function of each tool.arrow_forward
- There can be a quantitative determination of the degree of supercoiling in a DNA sample. True Falsearrow_forwardA urine sample has been obtained, and the bacteria in this sample were cultured. To obtain more information regarding the identity of this Gram-negative strain, Sanger sequencing can be used. A bacterial colony is transferred into a 0.2 mL tube containing buffer, then boiled to break open the bacterial cells. The tube is centrifuged, and some of the supernatant is transferred to a PCR tube. Next, the following reagents are added: DNA polymerase, a primer that binds near the 16S rRNA region of the bacterial chromosome, dNTPs, and fluorescently-labeled ddNTPs. The sequencing reaction is processed in a thermocycler, then analyzed by capillary electrophoresis. This experiment generates the following results (in FASTA format): > sequencing results TAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATG TCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATAC CGCATAACGTCGCAAGCACAAAGAGGGGGACCTTAGGGCCTCTTGCCATCGGA TGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACG…arrow_forwardIdentify if the following statements are true or false. Quantitative PCR is also known as the real-time PCR Real-time PCR method uses fluorescent dyes such as acridine orangearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License