Biology
12th Edition
ISBN: 9780134813448
Author: Audesirk, Teresa, Gerald, Byers, Bruce E.
Publisher: Pearson,
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 14.4, Problem 1TC
For any single person, a given STR always has either one or two bands. Why? Further, single bands are always about twice as bright as each band of a pair. For example, in the D16 STR on the right, the single bands of the first and third DNA samples are twice as bright as the pairs of bands of the second, fourth, and fifth samples. Why?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Whether done manually or automated, DNA sequencing gels are always made of polyacrylamide rather than agarose. Why can't agarose be used for a sequencing gel, as it is for other DNA gel electrophoresis?
Below are 9 possible primer pairs.● Determine which primer pair is the best choice.● Explain why the other primers are not good choices.● Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best.Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm =Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm =Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm =Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm =Forward 3: 5’ agattagcggatcctacctg 3’ Tm =Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm =Forward 4: 5’ cattgattatttgcacggcg 3’ Tm =Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm =Forward 5: 5’ tccataagattagcggatcc 3’ Tm =Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm =Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm=Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm =Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm =Reverse 7: 5’aggtcgactctagaggatc 3’ Tm =Forward 8: 5’ctacctgttccatggccaac 3’ Tm=Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm=Forward 9: 5’ tccataagattagcggatcc 3’ Tm =Reverse 9: 5’…
How would you estimate the size of the unknown DNA fragement just by looking at the gel?
Chapter 14 Solutions
Biology
Ch. 14.1 - define biotechnology?Ch. 14.1 - Prob. 2CYLCh. 14.1 - define GMO and transgenic organism?Ch. 14.2 - describe natural processes that recombine DNA,...Ch. 14.3 - Prob. 1CSCCh. 14.3 - Prob. 1CYLCh. 14.3 - summarize how CRISPR-Cas9 works and explain why it...Ch. 14.4 - For any single person, a given STR always has...Ch. 14.4 - There are many other applications in which DNA...Ch. 14.4 - Prob. 1CYL
Ch. 14.4 - Prob. 2CYLCh. 14.5 - Restriction enzymes are isolated from bacteria....Ch. 14.5 - Many countries regulate the use of genetically...Ch. 14.5 - explain how genes are inserted into a plasmid, and...Ch. 14.5 - Prob. 2CYLCh. 14.6 - Prob. 1CTCh. 14.6 - Prob. 1HYEWCh. 14.6 - describe the advantages of genetically modified...Ch. 14.6 - list some examples of how genetically modified...Ch. 14.6 - Prob. 3CYLCh. 14.7 - Explain how fetal DNA could be used to establish...Ch. 14.7 - explain how biotechnology is used to diagnose both...Ch. 14.7 - describe how transgenic organisms are used to...Ch. 14.7 - describe the procedures and advantages of gene...Ch. 14.8 - explain why people might be opposed to the use of...Ch. 14.8 - Prob. 2CYLCh. 14.8 - Prob. 1CTCh. 14 - Prob. 1MCCh. 14 - Prob. 3MCCh. 14 - A restriction enzyme a. cuts DNA at a specific...Ch. 14 - Prob. 5MCCh. 14 - Prob. 1FIBCh. 14 - _________is the process whereby bacteria pick up...Ch. 14 - The _______ is a technique tor multiplying DNA in...Ch. 14 - Matching DNA samples in forensics uses a specific...Ch. 14 - Prob. 5FIBCh. 14 - Describe two natural forms of genetic...Ch. 14 - Prob. 2RQCh. 14 - Prob. 3RQCh. 14 - Prob. 4RQCh. 14 - Prob. 5RQCh. 14 - Prob. 6RQCh. 14 - How does gel electrophoresis separate pieces of...Ch. 14 - Prob. 8RQCh. 14 - Prob. 9RQCh. 14 - Prob. 10RQCh. 14 - As you may know, many Insects have evolved...Ch. 14 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Why does the blood from the peripheral, tumor and breast samples all show bands of DNA that are 3000 bases and 1282 bases long?arrow_forwardTo prepare a sample for electrophoresis, samples of the DNA being investigated (a) are put into each of four tubes and induced to replicate (b). Also, into the first tube, an adenine terminator was added in addition to all the other nucleotides. As the complementary strand was being constructed, the terminators were occasionally incorporated wherever an adenine nucleotide was used. This random incorporation resulted in all possible lengths of DNA pieces that had an adenine on the end (c). The same process was conducted in the other tubes with thymine, guanine and cytosine terminators; one treatment for each of the four lanes in the gel. Electrophoresis separated the replicated pieces of DNA by size. Staining the gel revealed which lengths of the complementary DNA were terminated by which nucleotide terminators (d). The gel consists of four “lanes,” labeled A, T, G, and C, indicating either adenine, thymine, guanine, or cytosine terminated pieces of DNA. By “reading” down the gel, you…arrow_forwardIn our simple model of DNA amplification we assumed that a successful amplification doubled the DNA each cycle. Reality isn't so kind! Two related problems encountered in DNA profiling are the issues of asymmetric peaks and "drop-out" where an allele produces a small to very-small peak compared to the other allele. Assume you have a sample with a heterozygous set of alleles. Let one of the alleles be successfully doubled each cycle but the second allele is (on average) only increased by 1.8. If the sample is subjected to 30 PCR cycles, how much larger will the "successful" peak be than the "less successful" peak? Set your answer up as a ratio of the "successful" /"unsuccessful" and round your number to 1 decimal place. (for example, if your calculations show that after 30 cycles the successful allele has 55340 copies and the unsuccessful has 10000 copies the ratio is 5.5)arrow_forward
- Why was it necessary to mash the strawberries extensively with your hands? (hint: you wouldn’t have to do this step with an animal cells). Why do we treat the cells with soap when conducting DNA extraction? And why do we add salt when doing the DNA extraction?arrow_forwardA batch of this DNA is first fully digested by HpaI alone, then another batch is fully digested by HindIII alone, and finally, a third batch is fully digested by both HpaI and HindIII together. The fragments resulting from each of the three digestions are placed in separate wells of an agarose gel, separated by gel electrophoresis, and stained by ethidium bromide. Draw the bands as they would appear on the gel.arrow_forwardWhy does evenly distributed peak in DNA chromatogram is an indication of a good sequence?arrow_forward
- You have two tubes, each with a pair of DNA fragments inside them. Tube #1 has fragments that are 500bp and 1000 bp in length. Tube #2 has fragments that are 7500bp and 8000bp in size. If you were to perform agarose gel electrophoresis and run the contents of each tube in two separate lanes on the same gel, what would you expect to see? O That the difference between the distances migrated by the two fragments in Tube #1 was much greater than the difference between the distances migrated by the two fragments in Tube #2. O That the difference between the distances migrated by the two fragments in Tube #1 was the same as difference between the distances migrated by the two fragments in Tube #2. O That the difference between the distances migrated by the two fragments in Tube #1 was much less than the difference between the distances migrated by the two fragments in Tube #2. O It is not possible to estimate what we would expect to see.arrow_forwardA) Which molecule in the gel is the smallest - A, B, C, or D? Explain how you determined this. B) Identify one lane in this gel (1, 2, 3, 4, 5, 6, or 7) that shows evidence of DNase treatment. Explain how you determined this.arrow_forwardA DNA fragment with 450 bp will be closer to the top (negative pole) of an electrophoresis gel than one with 2,500 bp.True or false?arrow_forward
- A blood stain from a crime scene and blood samples from four suspects were analyzed by PCR using fluorescent primers associated with three STR loci: D3S1358, vWA, and FGA. The resulting electrophoretograms are shown below. The numbers beneath each peak identify the allele (upper box) and the height of the peak in relative fluorescence units (lower box). Solve, (a) Since everyone has two copies of each chromosome and therefore, two alleles of each gene, what accounts for the appearance ofonly one allele at some loci? (b) Which suspect is a possible source of the blood? (c) Could the suspect be identifi ed using just one of the three STR loci? (d) What can you conclude about the amount of DNA obtained from Suspect 1 compared to Suspect 4?arrow_forwardWhy is sodium acetate used in DNA precipitation by ethanol, rather than sodium chloride? (Hint – acetate is an organic ion. Chloride is not.)arrow_forwardHow would the appearance of your DNA gel change if a 0.1% agarose gel slab was used? What about a 7% agarose gel slab? For separating small fragments of DNA, is it better to use a 7% gel or a 0.1% gel? Why?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Serology 101: Testing for IgG and IgM antibodies; Author: Beckman Coulter Dx;https://www.youtube.com/watch?v=LtqKB-qpJrs;License: Standard youtube license