Biology
5th Edition
ISBN: 9781260487947
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 12.4, Problem 3EQ
Summary Introduction
To determine: The result which Nirenberg and Leder would have found out for the triplets AUG, UAA, UAG and UGA.
Introduction: In the Nirenberg and Leder experiment, the triples were found to have the special characteristics of causing the tRNA molecule to bind to a ribosome. The two scientists, Nirenberg and Leder discovered the concept of triplets in the mRNA molecules. The triplet is the RNA molecules containing the set of three
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
please answer for all three questions
asap
all three questions are related
Please asap
The human genome contains approximately 106 copies of an Alusequence, one of the best-studied classes of short interspersed elements(SINEs), per haploid genome. Individual Alu units share a282-nucleotide consensus sequence followed by a 3 @adenine@richtail region [Schmid (1998)]. Given that there are approximately3 * 10^9 base pairs per human haploid genome, about how manybase pairs are spaced between each Alu sequence?
Chapter 12 Solutions
Biology
Ch. 12.1 - What disease would result if a person inherited...Ch. 12.1 - Prob. 2CCCh. 12.1 - What is the direction of flow of genetic...Ch. 12.2 - Core Skill: Connections Look back at the role of...Ch. 12.3 - Prob. 1CCCh. 12.4 - Prob. 1CCCh. 12.4 - Prob. 1EQCh. 12.4 - Prob. 2EQCh. 12.4 - Prob. 3EQCh. 12.5 - Core Skill: Connections Look back at Figure 6.3,...
Ch. 12.5 - Prob. 2CSCh. 12.6 - Prob. 1CCCh. 12 - Which of the following best represents the central...Ch. 12 - A mutation prevents a gene from being transcribed...Ch. 12 - Prob. 3TYCh. 12 - Prob. 4TYCh. 12 - If a eukaryotic mRNA failed to have a cap attached...Ch. 12 - Prob. 6TYCh. 12 - Prob. 7TYCh. 12 - During the initiation of translation, the first...Ch. 12 - Prob. 9TYCh. 12 - Prob. 10TYCh. 12 - Prob. 1CQCh. 12 - Prob. 2CQCh. 12 - Prob. 3CQCh. 12 - Prob. 1COQCh. 12 - Prob. 2COQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…arrow_forwardNeed help 1) Say you have an organism with a genome of 1 thousand bases (103) and a forward primer made up of 5 nucleotides (aka, a 5-mer) a)How many possible 5-mers are there? Remember that each position in the 5-mer has one of four nucleotides. b) Pick a 5-nucleotide position at random in the genome: what’s the probability that your forward primer matches there? Focus for now just on one strand of DNA. c) Pick a random 5-nucleotide position in the genome: what’s the probability that your forward primer does NOT match there? Focus for now just on one strand of DNA. d) How many physical locations might your forward primer sit in the genome? Focus just on one strand of DNA. Ignore whether or not it matches at a given location. this is one question with different parts. I would really appreciate it if all parts are answered. and I will defiantly rate.arrow_forwardCalculate the number of clones required to obtain with a probability of 0.99 a specifi c 5-kb fragment from C. elegans (Table).arrow_forward
- Briefly explain the frameshift mutation ?arrow_forwardPayne, B. A. et al. (2013) present evidence that a low level of heteroplasmic mtDNA exists in all tested healthy individuals. (a) What are two likely sources of such heteroplasmy? (b) What genetic conditions within a given mitochondrion are likely to contribute to such a variable pool of mitochondria?arrow_forwardThe genome of Daphnia pulex, a small freshwater crustacean, includesapproximately 30,000 genes in ∼200,000 kb of DNA. How does the genome compare to that of Drosophila melanogaster, another arthropod, and to that of humans?arrow_forward
- Nonearrow_forwardFor each individual on each gel, determine if the individual is homozygous for presence of the Alu insertion(++), heterozygous (+-), homozygous for the absence of the Alu insertion (-), or if the results are inconclusive (I) (explain what makes you decide your determination, in detail). Explain what may have caused any unexpected bands (neither 850 nor 550) or lack of bands.arrow_forwardFor each individual on each gel, determine if the individual is homozygous for presence of the Alu insertion(++), heterozygous (+-), homozygous for the absence of the Alu insertion (-), or if the results are inconclusive (I) (explain what makes you decide your determination, in detail). Explain what may have caused any unexpected bands (neither 850 nor 550) or lack of bands.arrow_forward
- Typed and detailedarrow_forwardBased on the question,give an asnwer Question : Name the scoring matrix “A”. List the advantage(s) of this scoring matrix.arrow_forwardBL1250 Group activity 4 2020 (1) – Saved to my Mac v Mailings Review View Tell me EXERCISE 4 QUESTIONS 1. TRANSCRIPTION: Much research effort has been invested in understanding how transcription is regulated, because this process is very important for determining cell function. Transcription is a major on/ off switch for genes, providing the instructions for translation and determining the types and amounts of proteins made in a cell at a specific time. The Zebrafish is a model organism for research, and many biologists study how the regulation of genes affects the development of the zebrafish embryo. The effects of a variety of experimental conditions on zebrafish embryos can be easily visualized by light microscopy, because the outer covering (chorion) and the embryo are both transparent. See an images of zebrafish embryos at different time points in development and the adult form below. 0h Os 0.75 h 2h 3.25 h 8 h 16 h 24 h 72 h Adult -3 months (not to scale) Image from:…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY