Biology
5th Edition
ISBN: 9781260487947
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 12, Problem 1CQ
Summary Introduction
To explain: The reason by which the study of pathway leads to arginine synthesis allowed the conclusion that one gene sometimes encodes one enzyme by Beadle and Tatum.
Introduction: The one gene one enzyme concept was given by Beadle and Tatum. The concept emphasized about how a specific gene is specific for the synthesis of one enzyme. The specificity of gene expression was important to understand the mechanism behind the gene expression which later became the base of Human genome project and rDNA technologies.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Neurospora crassa can synthesize the amino acid arginine from a
precursor as follows:
precursor
ornithine
citrulline
arginine
George Beadle and Edward Tatum identified various mutants (arg
mutants) unable to synthesize arginine from this precursor. One such
class (Class I) could synthesize arginine if either ornithine or citrulline
was supplied. A second mutant class (Class II) could synthesize
arginine if citrulline was added, but not if ornithine was added. A
third class (Class III) could not synthesize arginine from either
ornithine or citrulline.
Which class or classes of arg mutants will grow on complete media?
Neurospora crassa can synthesize the amino acid arginine from a
precursor as follows:
precursor
ornithine - citrulline arginine
George Beadle and Edward Tatum identified various mutants (arg
mutants) unable to synthesize arginine from this precursor. One such
class (Class I) could synthesize arginine if either ornithine or citrulline
was supplied. A second mutant class (Class II) could synthesize
arginine if citrulline was added, but not if ornithine was added. A
third class (Class II) could not synthesize arginine from either
ornithine or citrulline.
Which class or classes of arg mutants LACK a functional enzyme
able to convert ornithine into citrulline?
I are studying pancreatic islet cells and have isolated, cloned, and sequenced a novel protein that you postulate has 4 transmembrane segments.
Explain why the sequence would lead to this hypothesis (what procedure would I have applied).
Chapter 12 Solutions
Biology
Ch. 12.1 - What disease would result if a person inherited...Ch. 12.1 - Prob. 2CCCh. 12.1 - What is the direction of flow of genetic...Ch. 12.2 - Core Skill: Connections Look back at the role of...Ch. 12.3 - Prob. 1CCCh. 12.4 - Prob. 1CCCh. 12.4 - Prob. 1EQCh. 12.4 - Prob. 2EQCh. 12.4 - Prob. 3EQCh. 12.5 - Core Skill: Connections Look back at Figure 6.3,...
Ch. 12.5 - Prob. 2CSCh. 12.6 - Prob. 1CCCh. 12 - Which of the following best represents the central...Ch. 12 - A mutation prevents a gene from being transcribed...Ch. 12 - Prob. 3TYCh. 12 - Prob. 4TYCh. 12 - If a eukaryotic mRNA failed to have a cap attached...Ch. 12 - Prob. 6TYCh. 12 - Prob. 7TYCh. 12 - During the initiation of translation, the first...Ch. 12 - Prob. 9TYCh. 12 - Prob. 10TYCh. 12 - Prob. 1CQCh. 12 - Prob. 2CQCh. 12 - Prob. 3CQCh. 12 - Prob. 1COQCh. 12 - Prob. 2COQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain genearrow_forwarda molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answerarrow_forwardusing example what is a degenerate primer? with the aid of diagrams discuss how degenerate primers are used to introduce random mutations in a gene and list some advantages and disadvantages of generating modified protein by this method .arrow_forward
- Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?arrow_forwardSuppose that the diagram below represents the genomic organization of an enzyme involved in eye pigment production in mice. Within the gene are four exons. Biochemical analysis has revealed that the active site of the enzyme is located in the C terminus of the protein. -The nucleotide length of each exon and intron is shown. -The dinucleotide sequence GT represents the 5’ splice site and the dinucleotide sequence AG represents the 3’ splice site. Both the 5’ and the 3’ splice sites must be present for splicing to occur. Assume that the first and second stop codons are located immediately after the first and second 5’ splice sites, respectively; the third and fourth stop codons are located near the 3’ end of exons 3 and 4, respectively; all these stop codons are in the correct reading frame. a) draw what the processed mRNA will look like. Include the start codon on the mRNA and label the approximate locations of the 5’ UTR and 3’ UTR on the transcript. (You do not need to add the 5’ CAP…arrow_forwardConsider the following tRNAs, where the numbered forms represent the amino acids associated with them, answer briefly: PICTURE Question 1: The numbering indicates the order in which these tRNAs are recruited to the A site of the ribosome. Write the sequence of the mRNA being translated in the 5' - 3' direction Question 2: What is the amino acid sequence of the produced polypeptide? Question 3: Researchers discover that a mutation is in the anticodon of the gene encoding the proline tRNA of an individual. The anticodon sequence is normally 3' GGA 5', but in this individual the anticodon sequence is 3' GGG 5'. It appears that this individual suffers no adverse consequences. How can this be? (2 response items)arrow_forward
- Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forwardWith regards to this sequence below please answer this quistions 1) What is the format of the sequence below and why 2) What do you understand by a query sequence 3) What is the sequence size of this sequence 4) What is the ID of the sequence and indicate the taxonomic rank of the ID ATGAAAAAACGAAAAGTGTTAATACCATTAATGGCATTGTCTACGATATTAGTTTCAAGCACAGGTAATT TAGAGGTGATTCAGGCAGAAGTTAAACAGGAGAACCGGTTATTAAATGAATCAGAATCAAGTTCCCAGGG GTTACTAGGATACTATTTTAGTGATTTGAATTTTCAAGCACCCATGGTGGTTACCTCTTCTACTACAGGG GATTTATCTATTCCTAGTTCTGATAGAAAATATTCCATCGGAAAACCAATATTTTCAATCTGCTATTTGG TCAGGATTTATCAAAGTTAAGAAGAGTGATGAATATACATTTGCTACTTCCGCTGATAATCATGTAACAA TGTGGGTAGATGACCAACAAGTGATTAATAAAGCTTCTAATTCTAACAAAATCAGATTAGAAAAAGGA AGATTATATCAAATAAAAATTCAATATCAACGAGAAAATCCTACTGAAAAAGGATTGGATTTCAAGTTGT ACTGGACCGATTCTCAAAATAAAAAAGAAGTGATTTCTAGTGATAACTTACAATTGCCAGAATTAAAACA AAAATCTTCGAACTCAAGAAAAAAGCGAAGTACAAGTGTGGACCTACGGTTCCAGACCGTGACAATGAT GGAATCCCTGATTCATTAGAGGTAGAAGGATATACGGTTGATGTCAAAAATAAAAGAACTTTTCTTTCAC…arrow_forwardRefer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?arrow_forward
- Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)arrow_forwardWhy nonhomologous end-joining (NHEJ) is helpful ?arrow_forwardExplain the reasoning for the establishment of three nucleotides codons.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mechanisms of Genetic Change or Evolution; Author: Scientist Cindy;https://www.youtube.com/watch?v=5FE8WvGzS4Q;License: Standard Youtube License