Microbiology: A Systems Approach
5th Edition
ISBN: 9781259706615
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 15TF
Plasmids are the only vectors currently available for use in recombinant procedures.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
You have set up a recombinant DNA experiment using the plasmid PBR322 as the vector (see plasmid below). You use the BamHI restriction site on the plasmid to insert the target DNA. The
plasmid is then used to transform E.coli colls Is the following statement True or False?
Growth of the transformed cells on agar containing both ampicillin and tetracycline will eliminate any cells that do not contain a plasmid.
Clal Hindlll
EcoRI
Pvul
BamHI
Pstl
amp
tet
PBR322
-Sall
ori
rop
Pvull
True
False
DEFINE THE FOLLOWING:
1) restriction enzyme
2) plasmid
3) recombinant DNA
"Plasmids are still the workhorses for many applicationsof recombinant DNA technology". Define the importance of this line ?
Chapter 10 Solutions
Microbiology: A Systems Approach
Ch. 10.1 - Provide examples of practical applications of...Ch. 10.2 - Prob. 2AYPCh. 10.2 - Describe how gel electrophoresis is used to...Ch. 10.2 - Prob. 4AYPCh. 10.2 - Prob. 5AYPCh. 10.3 - Prob. 6AYPCh. 10.3 - List examples of genetically modified bacteria,...Ch. 10.4 - Prob. 8AYPCh. 10.4 - Prob. 9AYPCh. 10.5 - Outline in general terms the process of DNA...
Ch. 10.5 - Prob. 11AYPCh. 10.5 - Prob. 12AYPCh. 10.5 - Prob. 13AYPCh. 10.6 - Prob. 14AYPCh. 10 - Which of the following is/are not essential to...Ch. 10 - Prob. 2MCQCh. 10 - The function of ligase is to a. rejoin segments of...Ch. 10 - The creation of biological molecules entirely from...Ch. 10 - Which of the following sequences, when combined...Ch. 10 - A region of DNA in a plasmid that is recognized by...Ch. 10 - Prob. 7MCQCh. 10 - Which of the following is a primary participant in...Ch. 10 - Single nucleotide polymorphisms are found in a....Ch. 10 - Microarrays are used to monitor a. the rate of DNA...Ch. 10 - Prob. 11TFCh. 10 - A nucleic acid probe can be used to identify...Ch. 10 - Prob. 13TFCh. 10 - In order to detect recombinant cells, plasmids...Ch. 10 - Plasmids are the only vectors currently available...Ch. 10 - You are a public health official trying to...Ch. 10 - a.Construct a strand of complementary DNA (cDNA)...Ch. 10 - a.Explain whether or not DNA polymerase from a...Ch. 10 - a.Define the term RFLP. Explain how RFLPs are...Ch. 10 - Prob. 5CTQCh. 10 - From chapter 6, figure 6.19. What has happened to...Ch. 10 - Prob. 2VCCh. 10 - Using the words that follow, please create a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In relation to the use of restriction enzymes in recombinant DNA technology, answer the following: You have accidentally torn the labels off two tubes (tube A and tube B), each containing a different plasmid, now you do not know which plasmid is in which tube. Fortunately, you have restriction maps for both plasmids, shown in Figure below. You have the opportunity to test just one sample from one of your tubes. By utilizing agarose gel electrophoresis technique, which restriction enzyme OR combination of restriction enzymes would you use in this experiment to determine which plasmid is found in which tube?. (Hint: if you use Hind III restriction enzyme you are going to get ONE single fragment with a molecular size of → 0.5+0.3+0.2+0.4+1+1 = 3.4 kb).arrow_forwardDiscuss TWO (2) common methods you could utilize to transform your recombinant plasmids into the host cell, BL21 (DE3).arrow_forwardMany resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer. A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing. Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance: > putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG…arrow_forward
- In bacterial transformation, the purpose of having antibiotic within an agar plate is to: Select one: confirm which plasmids been have successfully ligated with a gene of interest. isolate bacteria which have been successfully transformed with the plasmid. indicate which plasmids were successfully digested by the endonuclease. act as a substrate which will be cleaved and produce a blue product when ligation is unsuccessful. show which plasmids contain the lacZ gene.arrow_forwardBesides the pUC series, there are other plasmid vectors in the market such as pBR327 and pGEM-T. Some vectors are designed specifically for TA cloning while some are not. What is TA cloning? Explain in detail.arrow_forwardIn regards to using PCR: Explain why a plasmid is often engineered with tetR and lacZ. What purpose do they serve?arrow_forward
- We use a NanoDrop spectrophotometer to analyze plasmid DNA obtained from miniprep. Whatinformation about the plasmid does the 260nm reading alone provide and why?arrow_forwardWith reference to the image below, discuss the process and principle involved for screening/selection of hosts (last stage of cloning) containing the intended recombinant plasmid.arrow_forwardIn a transformation experiment, a sample of competent bacteria was mixed with a plasmid containing the gene for resistance to the antibiotic, ampicillin (ampr). Plasmid was not added to a second sample of bacteria. The samples were plated on nutrient agar plates, some of which were supplemented with the antibiotic ampicillin. The results of bacterial growth are summarised below. The shaded area represents extensive growth of bacteria; dots represent individual colonies of bacteria. Ampicillin No Ampicillin Bacteria Bacteria II No Ampicillin Ampicillin Bacteria + amp' plasmid Bacteria + amp' plasmid II IV Which are the plate(s) that have ONLY ampicillin-resistant bacteria growing? (a) Plate I only (b) Plate III only (c) Plate IV only (d) Plates I and II (e) Plates I and IIIarrow_forward
- With reference to the image below, discuss the process and principle involved for screening/selection ofhosts (last stage of cloning) containing the intended recombinant plasmid.arrow_forwardWhat is blue/white screening? What is the key feature of a plasmid that is used for it?arrow_forwardWhen using a conventional plasmid cloning vector containing a b-galactosidase gene, it is possible to perform a "blue-white screen" to determine which bacteria have taken up a plasmid into which a DNA fragment as been inserted, as opposed to those that have taken up just reclosed plasmid vector, by growing the transformed cells on nutrient agar plates containing the artificial b-gal substrate X-gal. Will bacteria that have taken up a plasmid into which a DNA fragment has been inserted form a blue colony or a white colony when grown on this medium? Briefly explain why these bacteria would form a colony of the color you chose.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License