What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 O 3- GCCTACGGGCATATG -5 O 5- GCCTACGGGCATAAG -3 O 5- GCCTACGGGCATATG -3 O 3- CGGATGCCCGTATAC -5

Q: Second Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original:…

A: So, the given information is:- ORIGINAL- AGAGAGAGAGAGAGAGAG…

Q: digest suspect B's DNA using restriction enzyme 1. Restriction enzyme 1 cleaves the recognition site…

A: The restriction enzymes are endonucleases that digest DNA (deoxyribonucleic acid) molecules by…

Q: What is the mRNA coded by this template DNA strand? DNA Template Strand: 3' ATGGTACGGTCG 5'…

A: A codon is known to code by three different types of bases in a particular mRNA. Hence, a codon is…

Q: functions. The structure that provides high processivity (processivity factor) is represented by the…

A: Letter A denotes core polymerase enzyme B denotes tau protein C denotes gamma clamp loader D denotes…

Q: Which of the following enzymes do not require a DNA template for nucleotide synthesis? *

A: DNA template is a DNA strand which is copied in to a complementary strand of DNA. According to the…

Q: DNA polymerase I DNA polymerase II DNA ligase Primase RNA primer 5' Lagging strand 3' 3' Okazaki…

A: The process of copying of double stranded DNA by the application of several Enzymes and proteins…

Q: What is the RNA transcript that would result from the double stranded DNA segment shown below?…

A: Gene expression is mostly dependent on the transcription process, which creates RNA from a DNA…

Q: Nde I EcoR I Sal I Kpn I BamH I PUST MCS ori Xho 1- Ampe BamH I Kpn I EcoR I BamH I gene W Xhe

A: Introduction  A chemical reaction is a process in which the reactants are converted into a product…

Q: Most prokaryotic organisms produce one or more enzymes to defend themselves against the infection by…

A: Bacteria constitute a wide domain of prokaryotic microbes with majorly varying lengths and a number…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA…

A: There are two types of nucleic acids, DNA and RNA. Nucleotides are the building blocks of nucleic…

Q: Single strand as a template plus 3' end to start DNA synthesis но- Polymerase works, DNA synthesis…

A: Addition of bases to the primer occurs as DNA replication proceeds :-

Q: Order the steps required to sequence a region of DNA using dideoxy sequencing. Amplify the region of…

A: Step 1: The order of the steps required to sequence a region of DNA using dideoxy sequencing…

Q: EcoRI --- 5' G - AATTC 3'       5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3'     3'…

A: The DNA is formed of several repeating units of monomers called nucleotides. The adjacent…

Q: EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments…

A: A restriction site or recognition site, is a specific sequence of nucleotides in DNA that a…

Q: 5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgte-5" The diagram above shows an RNA primer…

A: Given -  RNA primer :   B   5'-ccuaaucg-3"    C   Template strand :    A…

Q: following question is related to Restriction Enzymes and RFLP. Using EcoRl, which DNA sequence held…

A: Restriction enzymes, also known as restriction endonucleases, are a key tool in molecular biology.…

Q: the one above: Replicate this sense strand to create a double-stranded DNA helix…

A: DNA is a double helical structure containing complementary base pairs.  Complementary base pairs…

Q: A researcher wants to cut this piece of linear DNA. 5'…

A: The restriction enzymes are the specific enzymes that act on the DNA molecule and perform its…

Q: 5'- ATG CTG TTT GTA CGG GÁC TAA-3' a) Write out the DNA template side for the DNA coding side above?…

A: Introduction The term template strand refers to the sequence of DNA that is copied during the…

Q: 1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and…

A: DNA is a deoxyribonucleic acid. It is the double helical molecule which carries genetic information…

Q: Order the following steps according to the Sanger sequencing method The bands in the electrophoresis…

A: DNA sequencing is a technique used to evaluate the exact nucleotide bases , their position as well…

Q: Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this…

A: A codon is a three-nucleotide sequence of DNA or RNA that corresponds to a specific amino acid or…

Q: Match each statement with the best possible single answer from the list below. Terms may be used in…

A:

Q: The sequence of the transcript is 5'-GGUUACAUUC-3'. The sequence of the DNA template would be:…

A: Transcription is a biological process that occurs in the cells of living organisms, where genetic…

Q: Each sequence below indicates one of two strands of a DNA molecule. When heated, which of these DNA…

A: DNA( Deoxyribonucleic acid) is two stranded, twisted helical structure that serves as genetic…

Q: Consider the RNA sequence 5' AUGUUAGAUCGG 3' transcribed from the DNA molecule below. 1. 5'…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Induce a silent mutation in the template strand. Illustrate the output.

A: Mutation changes the sequence of nucleotides in a gene. The mutation is a random process.

Q: You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are…

A: Replication is the process by which the DNA generates a copy of itself. Transcription is the process…

Q: Circle the section on the DNA template where the example primer would bind.

A: A primer binds to a specific region of a single-stranded DNA template, known as the primer binding…

Q: ALL GROUPS HAVE A MUTATION MAKE SURE TO IDENTIFY THEM**

A: A mutation is a change in a DNA sequence. It can result from DNA copying errors made during cell…

Q: 5'-GUCAGCAU-3' but i need help understanding why is it.

A: Introduction In the majority of species, genetic information is stored in DNA. Each human cell has…

Q: Which of the primer sets will allow amplification of this DNA molecule? 5'…

A: In the realm of molecular biology and DNA analysis, the selection of appropriate primer sets is…

Q: DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl…

A: DNA polymerase is a main enzyme for DNA replication.. The two main requirements for working of  DNA…

Q: Design primers for PCR that would be able to amplify this entire DNA fragment.  -Design the primers…

A: AThe primer sequence is as follows: FORWARD PRIMER: 5' GCTCAGG 3' REVERSE PRIMER: 5'TCTATTA3'

Q: Bacteriophage T4 has a linear double-stranded DNA genome, yet mapping many mutations, as shown in…

A: T4 bacteriophage infects E.coli. It has a double stranded linear DNA genome. It undergoes a lytic…

Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…

A: DNA stands fo deoxyribonucleic acid. It is the genetic material.

Q: The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion…

A: DNA molecule is the genetic material present in the animals. Genetic material  is present in the…

Q: Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT…

A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus controls…

Q: BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would…

A:

Q: Genetics Attached is a segment of DNA (doublestranded). Answer the following questions about the…

A: Open reading frame is a part of genetic material which is responsible for expressing itself in the…

Q: What is the sequence of the newly synthesize DNA segment if the template strand has the following…

A: A DNA refers to a helical structure that is made of nucleotides. A nucleotide comprises a phosphate…

Q: A. If the technician forgot to add ddNTPs to the reaction, what would the sequencing chromatogram…

A: A technique for figuring out the nucleotide sequence of DNA is called Sanger sequencing, commonly…

Q: Using the numbered sites on the DNA double helix strands below, where would the DNA Primer ACTTGCGA…

A: Primers are short stretches of DNA that target unique sequences and help identify a unique part of…

Q: Fill in the chart and answer the two questions at the bottom of the picture.

A: Transcription is a process in which RNA is synthesized with the help of RNA polymerase enzyme using…

Q: given the following DNA template, write out the cDNA, mRNA, tRNA anticodons, and give the amino acid…

A: Anticodons are three-nucleotide sequences found in transfer RNA (tRNA) molecules. They are crucial…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.