BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?

Q: Sequence A AC GAATTC (EcoRI) NNNN... Sequence Probability Calculation Length 1 2 6 n 1/4 = (1/4)¹=…

A: DNA is two stranded , helical twisted structure that serves as genetic material in most of the…

Q: With a few exceptions, interspersed repetitive DNA in the human genome has no known biological…

A: Human genome: The term human genome refers to the complete set of genetic instructions or DNA that…

Q: 5. Assume that you are trying to do a gel mobility shift experiment using a normal set of Trp genes.…

A: The gel mobility shift assay is a biochemistry technique used to detect protein complexes with DNA.…

Q: 5. 2) Digestion of a 1.1kb fragment of plasmid DNA with BamHl produces two fragments of 700 bp and…

A: BamHI is a type II restriction endonuclease can identify specific restriction site and induce cut on…

Q: Indicate 2 differences between SSLP (simple sequence length polymorphism) and SNP (single nucleotide…

A: SSLPs are called Simple Sequence Length Polymorphism. These are arrays of repeat sequences that…

Q: a. What are all the transversions that can be made starting with the codon CGG?b. Which of these…

A: C<-> A, G   G<-> C,T   CGG transversion are the following   1 ACC   2 ACT   ЗАТТ   4 ATC…

Q: What is Simple sequence repeat?

A: The genome of every individual contains millions of genetic variation or variants which make each…

Q: A molecular geneticist hopes to find a Gene in human liver cell that codes for an important…

A: In heredity, gene occupies the basic physical and functional unit. They are found to be composed of…

Q: How would I solve this? primer (5’ TCAAAACG 3’ ) is shown hybridized to its template DNA below.…

A: The question inquires about the Sanger sequencing method, a strategy utilized to decide the grouping…

Q: The human genome (3.4Gb) would be 2.3 metres long if stretched linearly. In not more than 200 words,…

A: The size of a genome varies depending on the complexity of the genomes of different species.

Q: 1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the mRNA…

A: The coding strand of DNA is the one that contains the instructions for the gene in concern. The…

Q: explain: The kelch repeat domain in the problem in-line" or "plug-in" type domain.

A: Protein is a type of biomolecule. It is made up of a polypeptide chain, which is a chain of amino…

Q: Review concepts 21.5-21.6. Match term and its description. the mechanism contributes to polyploidy |…

A: Chromosomal aberrations are changes in structure or number of chromosomes. These include gain or…

Q: Transposons are useful as mutagens because they act asmolecular tags for genomic DNA sequences that…

A: Step 1 Transposons or jumping gene is a DNA (deoxyribonucleic acid) sequence that can change its…

Q: Question. What would the forward primer sequence look like if it were intended to bind the area of…

A: PCR, DNA sequencing, and genetic manipulation depend on DNA amplification in molecular biology and…

Q: If you have got the following DNA template molecules, which one of them will require more energy to…

A: The DNA is composed of purines and pyrimidines. The purines in DNA are adenine and guanine. The…

Q: COMPLEMENTARY

A: COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC is given below

Q: AGTGCATTTCCAGGGA Above is a randomly generated sequence of DNA 16 bp long. Determine the Tm of this…

A: The Temperature of Melting (Tm) is defined as the temperature at which 50% of double stranded DNA is…

Q: The structure of a typical pUC19/human DNA recombinant clone. Ensure that you clearly indicate the…

A: Plasmid vectors are circular and extra chromosomal DNA which are capable of self-replication.…

Q: a Given the following restriction map of a cloned 10 kb piece of DNA, what size fragments would you…

A: The process of fragmenting deoxyribonucleic acid strands with specific enzymes is restriction…

Q: 6.c. Mutated DNA Template Strand #3: 3'-TACTGAC TGACTATC-5' Complementary DNA sequence: mRNA…

A: The mutation is the change in the base sequence of the DNA nucleotide sequence or a gene. The…

Q: B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…

A: A silent mutation is a type of mutation that occurs in DNA where a single nucleotide is changed, but…

Q: IIT TTC amino acid sanon TTA TTG CTT СТС СТА СТG phenylalanine ATT АТС АТА leucine GTT GTC GTA GTG…

A: Sense strand of DNA- 5'-CATCCAAATTGTTGCCCG-3' Antisense strand of DNA-  3'- GTAGGTTTAACAACGGGC-5'…

Q: 5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgte-5" The diagram above shows an RNA primer…

A: Given -  RNA primer :   B   5'-ccuaaucg-3"    C   Template strand :    A…

Q: 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of…

A: The antisense DNA sequence is - 5' GGACCCTAT 3' The single nucleotide deletion can occur at any…

Q: That's the result of Gel electrophoresis of genomic DNA ( Of genomic DNA extraction experiment),…

A: Agarose gel electrophoresis is mainly used for nucleic acid separation due to its large pore size…

Q: When aligning the three sequences (ATGC, AATC, AATG), one can use a 3-D "Manhattan Grid", with each…

A: ANSWER: ATG-C AAT-C AA-TG

Q: 4. The bars in the following sequence indicate the break 5'-CGGGTAТСТАСТААА| TTCGCACTТАCGAGGAТТААСАТ…

A: Introduction : Primers are small, chemically synthesised oligonucleotides that are complementary to…

Q: 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of…

A: Sickle cell anemia is a disease caused by a mutation of the gene coding for hemoglobin leading to…

Q: Adds nucleotides in in the 5' to 3' direction during transcription. [Select ] [ Select ] ligase…

A: RNA polymerase

Q: Some enzymes are considered as molecular scissors. in genetic engenrring. What is the name assigned…

A: Genetic engineering is a process by which the genetic makeup of an organism can be altered. This…

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA…

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate…

Q: Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the…

A: Restriction endonucleases cut double stranded DNA at specific site or near specific site and form…

Q: A certain section of the coding (sense) strand of some DNA looks like this: SATGTATATCTCCAGTTAG-3…

A: Alternation of DNA sequence or any other charge in the chromosome shape or number is considered as a…

Q: Below is a generalized figure of replicating DNA. Describe what is occurring for each figure.

A: DNA replication is the process of new DNA synthesis from the old DNA molecule that occurs within the…

Q: 汽 (0 hope this picture, https://www.phys.kSu.edu/gene/photos/sd.html. 2 will help you imagine the…

A: Isolation is a microbiological technique in which individual bacterial colonies are separated from a…

Q: . a. What are all the transversions that can be made starting with the codon CGG?b. Which of these…

A: In molecular biology, a point mutation in DNA occurs when a single (two ring) purine (A or G) is…

Q: e. four-base, not overlapping4. An example of a portion of the T4 rIIB gene in whichCrick and…

A: The mutation is the alteration of the nucleotide sequence in an organism's genome. The mutation…

Q: Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to…

A: Introduction DNA acts as a genetic material in our body. DNA is a double stranded molecule. It is a…

Q: Primers designing for epitope tagging: Design forward and reverse primers to amplify the following…

A: Primers should generally have the following properties: 1. Length of 18-24 bases. 2. 40-60% G/C…

Q: GCT GAC ATC CTC CTC mutated DNA sequence           mutated mRNA sequence…

A: The flow of the genetic information is from DNA to RNA and RNA to protein. This flow of genetic…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.