What is the mRNA coded by this template DNA strand? DNA Template Strand: 3' ATGGTACGGTCG 5' TACCATGCCAGC 5' O3' TACCATGCCAGC 5' AUGGUACGGUCG 3" UACCAUGCCAGC 3' O 3' UACCAUGCCAGC 5'

Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…

A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…

Q: Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA:…

A: INTRODUCTION The DNA and it's corresponding mRNA is given below.

Q: The following DNAs were incubated with E. coli DNA Polymerase I and dNTPs. Write the products…

A: DNA replication is the process by which new DNA is synthesized from the old DNA by semiconservative…

Q: DNA sequence

A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…

Q: Given the following genomic sequence which contains 2 exons and CDNA sequence predict the amino acid…

A: The introns are the non-coding parts of the premature mRNA that must be removed by…

Q: The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' .…

A: DNA, short for deoxyribonucleic acid, is a nucleic acid molecule made up of a sugar called…

Q: The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the…

A: Introduction  Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: What is the DNA template for the RNA sequence 5' UAACGGAGCCUAAUC 3'? O 5' GAUUAGGCUCCGUUA 3' O 5'…

A: In reverse transcription, RNA is "reverse transcribed" into DNA. This process, catalyzed by reverse…

Q: What is the RNA transcript that would result from the double stranded DNA segment shown below?…

A: Gene expression is mostly dependent on the transcription process, which creates RNA from a DNA…

Q: AAUCCCAAU ITTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the…

A: Telomeres are the structures(caps) that are present at the end of the chromosomes, their fhbction is…

Q: If the template DNA is 3' A GCTAC5' then the mRNA sequence is

A: Ans- As mentioned the DNA template 3’ – A G C T A C – 5’ The mRNA sequence will be – a)          5’…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: The ds DNA strand between position 20-30 3'- GATACGCGATG- 5' The sequence of primer that will be…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following…

A: For protein synthesis, messenger RNA must be made from one strand of DNA called the template strand.…

Q: Restriction enzyme:   Recognition sequence:     Number of pieces of DNA:  Type of cut:

A: In the question a DNA sequence is given with its nucleotides.  Restriction enzyme is an enzyme that…

Q: The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5'…

A: DNA is double stranded & during replication both of its strands unwind to produce single…

Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…

A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…

Q: Given this mRNA strand: 3’ -   AUGAGGAAGGUA   - 5’; what are the components of the polypeptide?

A: Translation is the process in which the genetic message carried by mRNA from the DNA is converted in…

Q: elow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: DNA and RNA are the genetic material which have the genetic information about perticular organism…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by…

A: Transcription is the process by which the information contained in DNA  is converted into a…

Q: 5’ TAAGCGTAACCCGCTAA   CGTATGCGAAC   GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT   GCATACGCTTG…

A: The DNA is a double stranded molecule which are paired along with a complimentary strand. The above…

Q: 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: Transcription is the process of formation of RNA from a DNA. The RNA chain is synthesized in the…

Q: a. Write the template DNA (complementary strand) sequence for the wild type gene above  b. Write…

A: The coding strand is complementary to the template strand.  The template strand is the DNA sequence…

Q: Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the…

A: Introduction The process of duplicating a DNA molecule is known as DNA replication. When a cell…

Q: The following sequence is a double stranded DNA.…

A: The promoter region is a crucial segment of DNA located upstream (in the 5' direction) of a gene…

Q: a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: DNA is the genetic material of almost all living organisms. It contains information that is…

Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…

A: The process of gene expression involves the process of transcription followed by the process of…

Q: 1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and…

A: DNA is a deoxyribonucleic acid. It is the double helical molecule which carries genetic information…

Q: Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene:…

A: The double-stranded DNA molecule is made up of two DNA strands known as the template strand and the…

Q: D C 5' 3¹ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F)…

A: Transcription is the process by which mRNA is synthesized from DNA. Translation is the process of…

Q: Coding With the given coding strand perform the following 1. supply the correct non- coding strand…

A: DNA is a double helical molecule.

Q: Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to…

A: Amino acids are the basic units (monomers) that makeup proteins. They consolidate to frame short…

Q: Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first…

A: DNA DNA is a genetic material from which amino acid sequence or polypeptide chain are made.

Q: Shown below is a hypothetical RNA molecule. Which of the following corresponds to the template DNA…

A: RNA is produced from the DNA template by the process known as transcription that occurs within the…

Q: The sequence of the transcript is 5'-GGUUACAUUC-3'. The sequence of the DNA template would be:…

A: Transcription is a biological process that occurs in the cells of living organisms, where genetic…

Q: Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the…

A: Restriction endonucleases cut double stranded DNA at specific site or near specific site and form…

Q: All guanines in the top strand of following sequence undergo a chemical change so that they now pair…

A: Two identical DNA molecules, each made up of one original strand (the template strand) and one…

Q: For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’…

A: 4 codes are used by the DNA that areAdenine (A), Thymine (T),  Guanine (G), Cytosine (C)RNA also…

Q: The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using…

A: Introduction  Gene expression is the process through which a gene's information is utilised in the…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.