EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC-¹3
Q: Nucleic acids are polymers of nucleotides linked 3' to 5' by from which the bases project. O…
A: Nucleic acids are biomolecules that carry genetic information from one generation to the next…
Q: 3. Palmitate is radiolabeled at the position using 14C. This is added to a liver homogenate. Trace…
A: Palmitate is 16 carbon fatty acid and the distant carbon is labeled as ω carbon in the fatty acid,…
Q: Calculate the free energy changes at 20°C for the transmembrane movement of Na* and K* ions using…
A: Ions are distributed on either side of the cell membrane. The movement of ions across the membrane…
Q: Please identify the receptors shown on the cell (A-red, B-green, C-purple-pink) and how they…
A: The parietal cells that line the mammalian stomach does the function of pumping protons using proton…
Q: You want to maintain pH-7.0 for an enzyme-catalyzed reaction that will produce hydrogen ions along…
A: Here we are undertaking a reaction that will produce hydrogen ions (H+, generally termed as protons)…
Q: The catalytic mechanism of an enzyme found in the mitochondrial matrix (pH = 7.8) depends on an…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: Select only one of these types of GPCR and describe the signal transduction that is involved in that…
A: G-proteins coupled receptors (GPCR) are important and largest class of transmembrane receptors…
Q: Part II. Solving Genetics Problem. Do what is asked. Show your solution. A. Monohybrid Cross 1.…
A: Punnett square can determine the probability of each possible genotype (genetic makeup) and…
Q: What is Monoamine neurotransmitter, Amino-acid neurotransmitter, and neuropeptides?
A: Amino acids are a type of biomolecule that is involved in several biological and chemical functions…
Q: 4. Propose a two-step procedure to purify protein A from the other molecules (there are multiple…
A: Ion exchange chromatography is a powerful separation technique used to purify proteins and other…
Q: Please identify the following on the Michaelis- Menten plot shown A, B, C, and the X and Y axes.…
A: Enzymes kinetics - is the study of the reaction rate of enzyme catalyzed reactions. The reaction…
Q: Using the cultured cells used in this experiment and described in the introduction, how would you…
A: When increasing amounts of the labelled ligand are added to the cells, the amount of binding will…
Q: Regulation of the Citric Acid Cycle
A: TCA (Tricarboxylic acid) cycle is the major energy yielding metabolic pathway utilized by lifeforms.…
Q: The pH of a solution is determined by concentration of salt ⓇB relative concentration of acids and…
A: The correct answer is B - relative concentration of acids and bases. pH is a measure of the acidity…
Q: Sweetzyme IT Extra is a trademarked immobilized enzyme formulation of glucose isomerase sold by the…
A: Vmax = k2[E0] =0.570 s-1 × 2.30×10-5 M = 1.311×10-5 M s-1
Q: 6. A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCTGCTGACGCTGCTCGTCG-3'…
A: mRNA, or messenger RNA, is a type of RNA molecule that plays a central role in the process of…
Q: Regarding the glycolysis metabolic pathways covered in class: A. In the EMP metabolic pathway, what…
A: Glycolysis is a well known pathway that converts glucose to pyruvate. There are a series of…
Q: Can you explain the process of beta-oxidation for saturated and unsaturated fatty acids, and the…
A: Fatty acids are building block of fats in our body and it constitute a carboxylic acid with an…
Q: (a) () The isoelectric point (pl) of the protein, i.e., the pH at which the overall electrostatic…
A: The isoelectric point (pI) is the pH of a solution at which a given protein has a net charge of…
Q: Comparing chymotrypsin and subtilisin active site geometries on the assumption that their…
A: The approach of comparing the active site geometries of chymotrypsin and subtilisin to gain insights…
Q: Is vitamin c portly soluble of immediate solubility or highly soluble and what are the mol 1-1
A: Vitamins are small molecule which are required for normal functioning of the body. These molecules…
Q: what about proteins and fats
A: Fatty acids and phospholipids are the most common building blocks of lipids and are composed of a…
Q: What is released when myosin heads attach to actin filaments A. Phosphate B. ATP C. ADP D.…
A: Myosin and actin filaments are two proteins that help muscles contract. Myosin is a motor protein…
Q: Examine the structure below and answer the questions. (C) R H N OH a. Identify the type of molecule…
A: Biomolecules are the very essential macro molecules for the metabolism of the cell and the survival…
Q: Write the structure of the following peptides Expanded structure. Use any other ink for peptide…
A: The proteins are composed of twenty naturally occurring amino acids. The proteins are assembled by…
Q: What are the bond structures that help identify lipids? For example ester linkages and unsaturated…
A: Many biological processes rely on lipids, including energy storage, cell signalling, and membrane…
Q: Consider the polysaccharide to the right? a) What is the linkage between the sugar units? b) Is…
A: Disaccharides are carbohydrates made up of two monosaccharide units linked together by a glycosidic…
Q: There is an animal that uses almost 100 percent of the oxygen in its blood. Analyzing the Hb of this…
A: The answer provided discusses the implications of the findings that an animal uses almost 100…
Q: Which of the following is/are true about Okazaki fragments? 1. Okazaki fragments are found in the…
A: DNA replication is semi-conservative. The double helix of DNA unwinds during DNA replication and…
Q: There are several sugars along with fructose and glucose that are isomeric, name them
A: The question asked for a list of sugars that are isomeric to fructose and glucose. Isomers are…
Q: 2. Here is data to plot another STANDARD CURVE... Again, carefully consider how to scale and label…
A: Polyacrylamide gel electrophoresis (PAGE) is a technique used to separate proteins based on their…
Q: 7. An enzyme-catalyzed reaction proceeds by the mechanism below: E+S ← 1 E+A 3 EA EA+S4→ EAS --5→ EA…
A: The Rapid Equilibrium Assumption (REA) refers to the assumption that the formation of the…
Q: Report Would the Ninhydrin test be reliable in determining the presence of proteins? Explain. Will…
A: Since you have posted multiple questions, we will provide the solution only to the first five…
Q: Calculations for the Purification of a Recombi- nant Protein The purification of a recombinant…
A: The goal of this calculation is to determine the efficiency and success of each purification step…
Q: Write the peptides of the full name " RYJO NNALAMBA" Every symbol of the Fullname writes the…
A: Amino acids can be represented using a single letter representation and a three letter…
Q: When the disaccharide is hydrolyzed, monosaccharide units that are produced are
A: Carbohydrates are organic biomolecule composed of carbon, oxygen and hydrogen. Saccharides includes…
Q: The 4 graphs above represent the change in enzyme kinetics with the individual addition of different…
A: Enzymes kinetics - is the study of the reaction rate of enzyme catalyzed reactions. The reaction…
Q: Which one of the following concerning fermentation is correct? Kimchi's high salt content prevents…
A: Fermentation is a metabolic process in which microorganisms such as yeast and bacteria convert…
Q: Evaluate the texture of the two samples from experiment and what do the results in experiment 1 tell…
A: Starch is a complex carbohydrate found in many food products and is a major source of energy for…
Q: what makes lipids hydrophobic? what are the two key structural differences between lipids and the…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Why would LDH be up- or down-regulated depending on location of cancer cells? Anaerobic cancer…
A: Introduction glycolysis is a process by which glucose breaks into pyruvate. Glycolysis occurs both…
Q: In the Belmont Report, Relate the 3 major Bioethical Principles in the context of Biochemical…
A: The Belmont report puts forth a set of principles and guidelines that should be followed while…
Q: In chickens, the the B/b locus controls black vs. white feather color (black is dominant). The R/r…
A: We can use Punnett squares to determine the possible genotypes of Hermes and Muffin and then use…
Q: How many acetyl CoA molecules are produced in one cycle of beta oxidation? How many cycles…
A: During one cycle of beta oxidation, one acetyl CoA molecule is produced from a fatty acid molecule.…
Q: Calculate the ATP yield for the full catabolism of a phospholipid containing ethanolamine, C18:3 Δ9,…
A: The catabolism of a phospholipid containing ethanolamine and oleic acid begins with the breakdown of…
Q: Part I. First, you want to characterize the basic structure of the Super_Toxic1 gene. Identify the…
A: During transcription, the template strand of DNA is transcribed into a mRNA. This process requires…
Q: In two hours of a frozen potato the enzymes and molecules what happens to them
A: When a potato is frozen, the enzymes and molecules within it undergo several changes. During the two…
Q: In bacterial transforamtion, how should P+ and P- tubes look like after a successful transformation?
A: The tranformation process refers to introduction of foreign DNA in the bacteria cells. It is a type…
Q: a с STARR-seq construct ORF hkCP or dCP Enhancer ORF hkCP S2 STARR-seq 1,822 4,134 (32%) 3,586 pA…
A: The sets of genes in our genome can be broadly divided into 2 groups; Housekeeping genes and…
Q: On a single graph, sketch a qualitative velocity profile (velocity vs. time) for the enzymatic…
A: Activity of an enzyme is the amount of product produced per time. Relative activity of an enzyme is…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’EcoRI recognizes GA-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? -'3 5'-AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCCThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
- Table I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will travel the furthest? BAM HI: GGATCC CCTAGG AATCGGATCCATTTGGACTAAAGGACCCGGATTGGATCCAGGGCCTTTAGTACC TTAGCCTAGGTAAACCTGATTTCCTGGGCCTAACCTAGGTCCCGGAAATCATGG O 3 O 2 4. 1.
- The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction. The peaks are shown with shortest fragment on the left to longer fragments on the right. T •C A Select the DNA sequence that matches the data. 5-ТАТAСТТАСGAAGT-3' 5'-GTCCTACGGACGCG–3' 5'-ATATGAATGCTTCA–3' 5'-TGAAGCATTCATAT–3' 5-АСТТCGTAAGTATA-3'For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAAA TTGT TA T C CGC T CACA A T TCCACA CA A CATACGAG CCGGAAG CA T AA 110 120 130 140 150 160 СТТТААСАAТА ТАTTCAATTТС ATAACAATTTC GAAATTGTTATGiven the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: bottom strand is the noncoding strand). 5'-ААCGCATGAGAAAGCCCCCCGGAAGATCACСТТСCGGGGGCТТТАТАТААТТАGC-3' 3'-тTGCGTACтстттCGGGGGGCCTTCTAGTGGAAGGCCCCCGАААТАТАТТААТтCG-5' (i) Draw the structure of hairpin loop that will be formed during transcription. (ii) Illustrate how the hairpin loop structure initiates the termination of transcription.This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'