Which of the following is involved in the termination of translation in bacteria?   RF1 and RF2 A tRNA that binds to the stop codon EF-Tu and EF-G An amino acid specified by a stop codon A hairpin-loop structure on the mRNA

What is not found in a prokaryotic mRNA transcript? Stop codons AUG codons multiple adenines in the 3' end Uracils a coding region

Which one of the following is a codon for amino acid valine RNA triplet code GUU? AGT CAA GUC UGA ACC

Which of the following statements is true regarding the genetic code? O One DNA base contributes to two codons O Prokaryotes use a simple one-base code, while eukaryotes use a three-base code O Codons are translated as overlapping triplets O Most amino acids are coded for by more than one codon

An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that would be translated from this mRNA.

Which of the following is true about transfer RNA during translation? -Transfer RNA has anticodons that match with mRNA codons -Transfer RNA carries small ribosome subunits  - Transfer RNA carries fully-functioning proteins at the end of translation -Transfer RNA carries ATP for energy during translation

The genetic code is Random in that the codons for the same amino acid are structurally unrelated Read by pairing codons in TRNAS with anticodons in mRNAs Read by pairing anticodons in TRNAS with codons in MRNAS Redundant in that each codon can code for multiple amino acids

What is the one-letter amino acid sequence formed from the following mRNA that codes for a pentapeptide that is an endorphin called Leu-enkephalin? 5' AUG - UAC - GGU - GGA - UUU - CUA - UAA 3'

During translation, the mRNA template is read and amino acids corresponding to the codons are linked together. Use the labels on the left to identify the components of the image that are involved in translation. the growing polypeptide chain that becomes the new protein the mRNA transcript an uncharged tRNA that has been released from the E site a charged tRNA, carrying an amino acid the P site holds a tRNA with its amino acid bonded to the polypeptide chain the A site into which the charged tRNA will bind the ribosome ACC 44 GGGU a charged tRNA, carrying an amino acid AUG UAA

Failure to add the 3’ polyA tail will result in which of the following? The prokaryotic mRNA cannot be translated A break in the 5’-5’ triphosphate bond The eukaryotic mRNA is not transported outside the nucleus No changes, the polyA tail is not necessary